Mutagenetix > Incidental Mutation

Incidental Mutation 'R5547:Trim24'

436343

Institutional Source

Beutler Lab

Gene Symbol

Trim24

Ensembl Gene

ENSMUSG00000029833

Gene Name

tripartite motif-containing 24

Synonyms

D430004I05Rik, A130082H20Rik, TIF1alpha, Tif1a

MMRRC Submission

043105-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5547 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37847746-37943231 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37942485 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 965 (E965G)

Ref Sequence

ENSEMBL: ENSMUSP00000113063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]

AlphaFold

Q64127

Predicted Effect

probably damaging
Transcript: ENSMUST00000031859
AA Change: E999G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: E999G

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	2.5e-10	SMART
BBOX	158	205	2e-13	SMART
BBOX	218	259	7e-14	SMART
BBC	266	392	3e-44	SMART
low complexity region	474	491	N/A	INTRINSIC
low complexity region	501	514	N/A	INTRINSIC
low complexity region	573	598	N/A	INTRINSIC
low complexity region	686	709	N/A	INTRINSIC
low complexity region	759	774	N/A	INTRINSIC
PHD	829	872	2.1e-13	SMART
BROMO	902	1007	2.4e-40	SMART
low complexity region	1025	1033	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120238
AA Change: E929G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: E929G

Domain	Start	End	E-Value	Type
BBOX	88	135	2e-13	SMART
BBOX	148	189	6.8e-14	SMART
BBC	196	322	3e-44	SMART
low complexity region	404	421	N/A	INTRINSIC
low complexity region	431	444	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	616	639	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
PHD	759	802	2e-13	SMART
BROMO	832	937	2.4e-40	SMART
low complexity region	955	963	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120428
AA Change: E965G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: E965G

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	5.22e-8	SMART
BBOX	158	205	6.27e-11	SMART
BBOX	218	259	2.22e-11	SMART
BBC	266	392	5.86e-42	SMART
low complexity region	539	564	N/A	INTRINSIC
low complexity region	652	675	N/A	INTRINSIC
low complexity region	725	740	N/A	INTRINSIC
PHD	795	838	3.15e-11	SMART
BROMO	868	973	3.95e-38	SMART
low complexity region	991	999	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh7a1	A	G	18: 56,661,356 (GRCm39)	S492P	probably damaging	Het
Arfgef1	A	T	1: 10,231,201 (GRCm39)	D1133E	probably damaging	Het
Avpi1	T	C	19: 42,113,382 (GRCm39)	K25R	probably damaging	Het
Bank1	T	C	3: 135,772,110 (GRCm39)	S708G	probably damaging	Het
C1qtnf2	A	G	11: 43,381,794 (GRCm39)	E202G	probably damaging	Het
C6	T	A	15: 4,837,970 (GRCm39)	V860E	probably benign	Het
Cbr1	T	A	16: 93,406,698 (GRCm39)	V138E	probably damaging	Het
Cdip1	A	G	16: 4,587,988 (GRCm39)	S2P	probably damaging	Het
Cep126	T	C	9: 8,100,428 (GRCm39)	N702S	probably damaging	Het
Chek1	T	C	9: 36,623,400 (GRCm39)	I381V	probably benign	Het
Clock	G	A	5: 76,378,185 (GRCm39)	P572S	probably benign	Het
Cryz	C	T	3: 154,317,194 (GRCm39)	R138*	probably null	Het
Ctsll3	T	A	13: 60,948,551 (GRCm39)	M103L	probably benign	Het
Daxx	TGATGATGACGATGATGACGATGATGA	TGATGATGACGATGATGA	17: 34,131,615 (GRCm39)		probably benign	Het
Daxx	CGATGATGATGA	CGA	17: 34,131,633 (GRCm39)		probably benign	Het
Dsg1a	T	G	18: 20,469,097 (GRCm39)		probably null	Het
Eya4	T	C	10: 22,985,753 (GRCm39)	E583G	possibly damaging	Het
Flt1	T	A	5: 147,591,948 (GRCm39)	S505C	probably damaging	Het
Gpr161	C	A	1: 165,133,982 (GRCm39)	F81L	possibly damaging	Het
H2-T15	G	A	17: 36,368,796 (GRCm39)	H95Y	possibly damaging	Het
Hmcn1	A	G	1: 150,613,257 (GRCm39)	V1390A	possibly damaging	Het
Ifi44l	C	T	3: 151,467,142 (GRCm39)	V63I	unknown	Het
Klhl3	C	T	13: 58,250,243 (GRCm39)		probably null	Het
Lekr1	T	A	3: 65,576,601 (GRCm39)		probably null	Het
Lhx5	A	G	5: 120,572,675 (GRCm39)	Q98R	probably benign	Het
Nuggc	A	G	14: 65,879,330 (GRCm39)	K681E	possibly damaging	Het
Numa1	G	T	7: 101,663,137 (GRCm39)	A735S	probably damaging	Het
Oog3	A	T	4: 143,884,598 (GRCm39)	L446Q	probably benign	Het
Or5ac19	G	A	16: 59,089,479 (GRCm39)	L184F	probably benign	Het
Otogl	C	T	10: 107,617,909 (GRCm39)	E1735K	possibly damaging	Het
Pcsk5	T	C	19: 17,729,488 (GRCm39)	D119G	probably benign	Het
Pgpep1	T	C	8: 71,105,069 (GRCm39)	K64E	probably benign	Het
Prr19	A	C	7: 25,003,388 (GRCm39)	D334A	probably damaging	Het
Ptprh	G	T	7: 4,557,221 (GRCm39)	S691*	probably null	Het
Recql4	G	A	15: 76,589,994 (GRCm39)	R684*	probably null	Het
Rnf112	C	T	11: 61,341,854 (GRCm39)	V317I	possibly damaging	Het
Rnf40	T	C	7: 127,188,302 (GRCm39)		probably null	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Spag17	T	C	3: 99,963,468 (GRCm39)	V1062A	probably benign	Het
Tbc1d1	A	G	5: 64,481,887 (GRCm39)	D696G	possibly damaging	Het
Tdo2	T	C	3: 81,866,247 (GRCm39)	R339G	probably damaging	Het
Tmem245	C	T	4: 56,910,156 (GRCm39)		probably null	Het
Trmt112	T	C	19: 6,888,156 (GRCm39)	S103P	probably damaging	Het
Trpv6	A	T	6: 41,613,088 (GRCm39)	V26D	possibly damaging	Het
Zfp850	A	G	7: 27,688,844 (GRCm39)	C455R	probably damaging	Het
Zfp946	T	C	17: 22,673,873 (GRCm39)	I209T	probably benign	Het
Zfp957	T	C	14: 79,451,406 (GRCm39)	N131S	probably benign	Het

Other mutations in Trim24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Trim24	APN	6	37,880,583 (GRCm39)	missense	possibly damaging	0.76
IGL01307:Trim24	APN	6	37,942,570 (GRCm39)	missense	possibly damaging	0.81
IGL01790:Trim24	APN	6	37,922,548 (GRCm39)	missense	probably benign
IGL02525:Trim24	APN	6	37,922,653 (GRCm39)	missense	probably damaging	0.99
IGL02557:Trim24	APN	6	37,942,434 (GRCm39)	critical splice acceptor site	probably null
IGL02671:Trim24	APN	6	37,937,719 (GRCm39)	missense	probably damaging	1.00
IGL02795:Trim24	APN	6	37,896,324 (GRCm39)	missense	probably damaging	1.00
IGL02877:Trim24	APN	6	37,942,581 (GRCm39)	missense	probably damaging	1.00
IGL02889:Trim24	APN	6	37,934,696 (GRCm39)	missense	probably benign	0.02
IGL02930:Trim24	APN	6	37,928,380 (GRCm39)	splice site	probably benign
IGL03076:Trim24	APN	6	37,942,567 (GRCm39)	missense	probably damaging	0.98
accomodating	UTSW	6	37,896,332 (GRCm39)	missense	probably damaging	1.00
apprehensive	UTSW	6	37,934,435 (GRCm39)	splice site	probably benign
Flexible	UTSW	6	37,880,588 (GRCm39)	critical splice donor site	probably benign
Lithe	UTSW	6	37,935,504 (GRCm39)	missense	probably damaging	1.00
Nervous	UTSW	6	37,934,664 (GRCm39)	missense	probably damaging	1.00
perturbed	UTSW	6	37,896,427 (GRCm39)	critical splice donor site	probably null
pliant	UTSW	6	37,896,426 (GRCm39)	critical splice donor site	probably null
qualmish	UTSW	6	37,880,587 (GRCm39)	critical splice donor site	probably null
Queasy	UTSW	6	37,885,240 (GRCm39)	missense	probably damaging	0.99
squeamish	UTSW	6	37,892,137 (GRCm39)	nonsense	probably null
uneasy	UTSW	6	37,933,412 (GRCm39)	critical splice donor site	probably null
PIT4651001:Trim24	UTSW	6	37,877,667 (GRCm39)	critical splice donor site	probably null
R0037:Trim24	UTSW	6	37,934,484 (GRCm39)	missense	probably damaging	1.00
R0037:Trim24	UTSW	6	37,934,484 (GRCm39)	missense	probably damaging	1.00
R0183:Trim24	UTSW	6	37,920,415 (GRCm39)	missense	possibly damaging	0.90
R0471:Trim24	UTSW	6	37,892,130 (GRCm39)	missense	possibly damaging	0.94
R0485:Trim24	UTSW	6	37,934,001 (GRCm39)	missense	probably damaging	1.00
R0606:Trim24	UTSW	6	37,848,169 (GRCm39)	missense	probably benign
R0609:Trim24	UTSW	6	37,934,718 (GRCm39)	missense	probably damaging	1.00
R0637:Trim24	UTSW	6	37,935,494 (GRCm39)	splice site	probably null
R0734:Trim24	UTSW	6	37,896,400 (GRCm39)	missense	possibly damaging	0.86
R0855:Trim24	UTSW	6	37,892,137 (GRCm39)	nonsense	probably null
R1131:Trim24	UTSW	6	37,934,717 (GRCm39)	missense	probably damaging	1.00
R1141:Trim24	UTSW	6	37,892,228 (GRCm39)	missense	probably damaging	1.00
R1159:Trim24	UTSW	6	37,933,412 (GRCm39)	critical splice donor site	probably null
R1460:Trim24	UTSW	6	37,941,761 (GRCm39)	missense	probably damaging	1.00
R1672:Trim24	UTSW	6	37,892,214 (GRCm39)	missense	probably damaging	1.00
R1868:Trim24	UTSW	6	37,928,447 (GRCm39)	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37,934,013 (GRCm39)	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37,934,013 (GRCm39)	missense	probably damaging	0.99
R1894:Trim24	UTSW	6	37,934,013 (GRCm39)	missense	probably damaging	0.99
R1913:Trim24	UTSW	6	37,934,750 (GRCm39)	missense	probably damaging	1.00
R2254:Trim24	UTSW	6	37,935,612 (GRCm39)	missense	probably benign
R2511:Trim24	UTSW	6	37,880,587 (GRCm39)	critical splice donor site	probably null
R2849:Trim24	UTSW	6	37,933,388 (GRCm39)	missense	probably damaging	0.99
R3878:Trim24	UTSW	6	37,941,708 (GRCm39)	missense	probably benign	0.14
R4084:Trim24	UTSW	6	37,892,192 (GRCm39)	missense	probably damaging	1.00
R4235:Trim24	UTSW	6	37,941,675 (GRCm39)	missense	probably damaging	1.00
R4292:Trim24	UTSW	6	37,877,627 (GRCm39)	missense	possibly damaging	0.91
R4633:Trim24	UTSW	6	37,933,371 (GRCm39)	missense	probably damaging	0.98
R4651:Trim24	UTSW	6	37,934,774 (GRCm39)	critical splice donor site	probably null
R4652:Trim24	UTSW	6	37,934,774 (GRCm39)	critical splice donor site	probably null
R4686:Trim24	UTSW	6	37,885,240 (GRCm39)	missense	probably damaging	0.99
R5000:Trim24	UTSW	6	37,935,547 (GRCm39)	missense	probably benign	0.01
R5213:Trim24	UTSW	6	37,934,010 (GRCm39)	missense	probably damaging	0.99
R5258:Trim24	UTSW	6	37,896,335 (GRCm39)	missense	probably benign	0.37
R5292:Trim24	UTSW	6	37,880,539 (GRCm39)	missense	probably benign	0.23
R5395:Trim24	UTSW	6	37,934,679 (GRCm39)	missense	probably damaging	1.00
R5666:Trim24	UTSW	6	37,942,536 (GRCm39)	missense	probably benign	0.19
R5670:Trim24	UTSW	6	37,942,536 (GRCm39)	missense	probably benign	0.19
R5849:Trim24	UTSW	6	37,934,664 (GRCm39)	missense	probably damaging	1.00
R5927:Trim24	UTSW	6	37,935,504 (GRCm39)	missense	probably damaging	1.00
R5932:Trim24	UTSW	6	37,934,010 (GRCm39)	missense	probably damaging	0.99
R6286:Trim24	UTSW	6	37,896,426 (GRCm39)	critical splice donor site	probably null
R6374:Trim24	UTSW	6	37,930,484 (GRCm39)	missense	probably benign	0.12
R6449:Trim24	UTSW	6	37,880,587 (GRCm39)	critical splice donor site	probably null
R6723:Trim24	UTSW	6	37,928,403 (GRCm39)	missense	probably benign	0.00
R6731:Trim24	UTSW	6	37,920,420 (GRCm39)	missense	probably damaging	0.99
R6975:Trim24	UTSW	6	37,896,427 (GRCm39)	critical splice donor site	probably null
R7000:Trim24	UTSW	6	37,935,613 (GRCm39)	missense	probably benign	0.24
R7067:Trim24	UTSW	6	37,934,775 (GRCm39)	splice site	probably null
R7126:Trim24	UTSW	6	37,896,392 (GRCm39)	missense	probably damaging	1.00
R7162:Trim24	UTSW	6	37,942,456 (GRCm39)	missense	possibly damaging	0.68
R7486:Trim24	UTSW	6	37,934,774 (GRCm39)	critical splice donor site	probably null
R7779:Trim24	UTSW	6	37,896,333 (GRCm39)	missense	probably damaging	0.99
R7779:Trim24	UTSW	6	37,896,332 (GRCm39)	missense	probably damaging	1.00
R8070:Trim24	UTSW	6	37,934,661 (GRCm39)	missense	probably damaging	0.99
R8096:Trim24	UTSW	6	37,935,592 (GRCm39)	missense	probably benign	0.03
R8184:Trim24	UTSW	6	37,848,242 (GRCm39)	missense	probably damaging	1.00
R8323:Trim24	UTSW	6	37,892,233 (GRCm39)	critical splice donor site	probably null
R8476:Trim24	UTSW	6	37,922,578 (GRCm39)	nonsense	probably null
R8705:Trim24	UTSW	6	37,880,588 (GRCm39)	critical splice donor site	probably benign
R8770:Trim24	UTSW	6	37,934,435 (GRCm39)	splice site	probably benign
R9021:Trim24	UTSW	6	37,933,949 (GRCm39)	missense	probably damaging	0.99
R9166:Trim24	UTSW	6	37,934,074 (GRCm39)	missense	probably damaging	1.00
R9212:Trim24	UTSW	6	37,896,335 (GRCm39)	missense	probably benign	0.37
R9350:Trim24	UTSW	6	37,892,208 (GRCm39)	missense	probably damaging	1.00
R9678:Trim24	UTSW	6	37,942,449 (GRCm39)	missense	probably damaging	1.00
RF007:Trim24	UTSW	6	37,930,471 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGTACAAAGTGTAACCCCAGACTAG -3'
(R):5'- TGCGGCGTTACTTAAGCAGC -3'

Sequencing Primer
(F):5'- GTGTAACCCCAGACTAGTATTTTG -3'
(R):5'- AGCTGGCGATCCTCGGTG -3'

Posted On

2016-10-24