Incidental Mutation 'R0006:Vmn1r20'
ID43636
Institutional Source Beutler Lab
Gene Symbol Vmn1r20
Ensembl Gene ENSMUSG00000115253
Gene Namevomeronasal 1 receptor 20
SynonymsGm5569
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57428930-57435261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57432305 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 205 (H205Q)
Ref Sequence ENSEMBL: ENSMUSP00000153815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176085] [ENSMUST00000226808] [ENSMUST00000227909]
Predicted Effect probably damaging
Transcript: ENSMUST00000176085
AA Change: H205Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134973
Gene: ENSMUSG00000093679
AA Change: H205Q

DomainStartEndE-ValueType
Pfam:V1R 28 293 2.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226808
AA Change: H205Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227909
AA Change: H205Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Vmn1r20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Vmn1r20 APN 6 57431740 missense probably damaging 1.00
IGL02622:Vmn1r20 APN 6 57432598 missense probably damaging 0.99
IGL02636:Vmn1r20 APN 6 57431761 missense probably benign
R0079:Vmn1r20 UTSW 6 57431792 missense possibly damaging 0.70
R0200:Vmn1r20 UTSW 6 57432099 missense probably damaging 0.96
R1675:Vmn1r20 UTSW 6 57431952 missense probably benign 0.00
R1734:Vmn1r20 UTSW 6 57432300 missense probably damaging 1.00
R1883:Vmn1r20 UTSW 6 57432321 missense probably benign 0.14
R2049:Vmn1r20 UTSW 6 57431958 missense probably damaging 1.00
R2307:Vmn1r20 UTSW 6 57432136 missense probably benign 0.03
R2346:Vmn1r20 UTSW 6 57431946 missense possibly damaging 0.83
R4405:Vmn1r20 UTSW 6 57432057 missense probably benign 0.02
R4946:Vmn1r20 UTSW 6 57432174 missense probably damaging 0.98
R5259:Vmn1r20 UTSW 6 57432065 nonsense probably null
R5321:Vmn1r20 UTSW 6 57432442 missense probably benign 0.21
R5911:Vmn1r20 UTSW 6 57431789 missense probably benign 0.16
R6042:Vmn1r20 UTSW 6 57432406 missense possibly damaging 0.90
R6298:Vmn1r20 UTSW 6 57432127 missense probably benign
R6314:Vmn1r20 UTSW 6 57432057 missense probably benign 0.00
R6331:Vmn1r20 UTSW 6 57431670 unclassified probably null
R6482:Vmn1r20 UTSW 6 57432108 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCAGGCTGTCACAATCAGTCCC -3'
(R):5'- ACCCTCAGGATGACTGTGTCATACC -3'

Sequencing Primer
(F):5'- CTACAGTAGTAGCCGGATCTTCTATG -3'
(R):5'- GGATGACTGTGTCATACCTCCAC -3'
Posted On2013-05-29