Incidental Mutation 'R0006:Olfr1348'
ID43638
Institutional Source Beutler Lab
Gene Symbol Olfr1348
Ensembl Gene ENSMUSG00000093877
Gene Nameolfactory receptor 1348
SynonymsMOR103-9, GA_x6K02T2QGBW-3232059-3231121
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0006 (G1)
Quality Score117
Status Validated
Chromosome7
Chromosomal Location6499793-6508748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6501611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 205 (I205T)
Ref Sequence ENSEMBL: ENSMUSP00000150969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086319] [ENSMUST00000207055] [ENSMUST00000207339] [ENSMUST00000207624] [ENSMUST00000208066] [ENSMUST00000208207] [ENSMUST00000208623] [ENSMUST00000209029] [ENSMUST00000209055] [ENSMUST00000209097] [ENSMUST00000213549] [ENSMUST00000214383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086319
AA Change: I211T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083499
Gene: ENSMUSG00000093877
AA Change: I211T

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 4.9e-50 PFAM
Pfam:7tm_1 51 300 2.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207055
Predicted Effect probably benign
Transcript: ENSMUST00000207339
Predicted Effect probably benign
Transcript: ENSMUST00000207624
Predicted Effect possibly damaging
Transcript: ENSMUST00000208066
AA Change: I205T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000208207
Predicted Effect probably benign
Transcript: ENSMUST00000208623
Predicted Effect possibly damaging
Transcript: ENSMUST00000209029
AA Change: I205T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000209055
Predicted Effect probably benign
Transcript: ENSMUST00000209097
Predicted Effect possibly damaging
Transcript: ENSMUST00000213549
AA Change: I205T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214383
AA Change: I205T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218572
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Olfr1348
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Olfr1348 APN 7 6501900 missense probably benign 0.00
IGL03157:Olfr1348 APN 7 6501893 missense probably damaging 1.00
R1763:Olfr1348 UTSW 7 6501441 missense probably benign 0.07
R2178:Olfr1348 UTSW 7 6501488 missense probably damaging 0.98
R5787:Olfr1348 UTSW 7 6501990 missense probably damaging 1.00
R5884:Olfr1348 UTSW 7 6501843 missense probably benign 0.02
R6248:Olfr1348 UTSW 7 6501676 nonsense probably null
R7026:Olfr1348 UTSW 7 6501821 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGCTGAGTAAAAGATGCCCACC -3'
(R):5'- TATGTGTCAGTCACCATGCCCACC -3'

Sequencing Primer
(F):5'- CACTACCAGATGGGAGGCAC -3'
(R):5'- ATAGTCCTCATCTGCACAGAGTG -3'
Posted On2013-05-29