Incidental Mutation 'R5558:2810403A07Rik'
List |< first << previous [record 56 of 10171] next >> last >|
ID436388
Institutional Source Beutler Lab
Gene Symbol 2810403A07Rik
Ensembl Gene ENSMUSG00000028060
Gene NameRIKEN cDNA 2810403A07 gene
Synonyms
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88685803-88712924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88693096 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 164 (H164P)
Ref Sequence ENSEMBL: ENSMUSP00000142760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029696] [ENSMUST00000198042] [ENSMUST00000198078] [ENSMUST00000199684]
Predicted Effect probably damaging
Transcript: ENSMUST00000029696
AA Change: H164P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029696
Gene: ENSMUSG00000028060
AA Change: H164P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 2e-28 BLAST
PDB:2YQR|A 229 340 6e-76 PDB
Blast:KH 233 319 1e-36 BLAST
SCOP:d1k1ga_ 233 327 4e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 566 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197479
Predicted Effect probably damaging
Transcript: ENSMUST00000198042
AA Change: H164P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142773
Gene: ENSMUSG00000028060
AA Change: H164P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198078
AA Change: H164P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142760
Gene: ENSMUSG00000028060
AA Change: H164P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 5e-29 BLAST
PDB:2YQR|A 229 340 1e-77 PDB
Blast:KH 233 319 3e-37 BLAST
SCOP:d1k1ga_ 233 327 4e-17 SMART
low complexity region 410 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198589
Predicted Effect probably damaging
Transcript: ENSMUST00000199684
AA Change: H164P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142353
Gene: ENSMUSG00000028060
AA Change: H164P

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200364
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in 2810403A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0085:2810403A07Rik UTSW 3 88711739 missense probably damaging 0.99
R0271:2810403A07Rik UTSW 3 88686329 splice site probably benign
R1160:2810403A07Rik UTSW 3 88708862 missense probably damaging 0.99
R2348:2810403A07Rik UTSW 3 88708876 missense probably benign 0.01
R3121:2810403A07Rik UTSW 3 88689292 missense probably damaging 1.00
R3546:2810403A07Rik UTSW 3 88693136 splice site probably benign
R3548:2810403A07Rik UTSW 3 88693136 splice site probably benign
R4688:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R5249:2810403A07Rik UTSW 3 88696725 missense probably damaging 1.00
R5393:2810403A07Rik UTSW 3 88696606 missense probably benign 0.08
R5579:2810403A07Rik UTSW 3 88700275 missense probably benign
R5782:2810403A07Rik UTSW 3 88711678 missense probably damaging 0.96
R5809:2810403A07Rik UTSW 3 88708885 missense probably damaging 0.96
R6415:2810403A07Rik UTSW 3 88699972 missense probably benign 0.25
R6566:2810403A07Rik UTSW 3 88711654 missense probably damaging 0.99
R6765:2810403A07Rik UTSW 3 88686429 missense probably damaging 1.00
R6939:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTAAGACTGCTAGGAATTGAG -3'
(R):5'- GAATGGACTAATGCTCAATGTACC -3'

Sequencing Primer
(F):5'- GGTCACAAAGTTGAGATCCTTCTGC -3'
(R):5'- AATATGCAGCTCCCATCC -3'
Posted On2016-10-24