Mutagenetix > Incidental Mutation

Incidental Mutation 'R5560:Pikfyve'

436487

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

043117-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65292566 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1339 (Y1339C)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1294C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1294C

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: Y1339C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1339C

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Meta Mutation Damage Score

0.9564

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,456,354 (GRCm39)	E98K	possibly damaging	Het
Adipor1	T	C	1: 134,353,778 (GRCm39)	W188R	possibly damaging	Het
Agrn	T	C	4: 156,262,954 (GRCm39)	D441G	probably damaging	Het
Ankrd55	T	C	13: 112,520,024 (GRCm39)	S570P	probably benign	Het
Ano9	C	G	7: 140,690,395 (GRCm39)	G80R	probably damaging	Het
Arhgef2	T	A	3: 88,541,744 (GRCm39)	V250E	probably damaging	Het
Atp2b2	T	C	6: 113,751,319 (GRCm39)	D583G	possibly damaging	Het
Bcar3	T	A	3: 122,220,224 (GRCm39)	D40E	possibly damaging	Het
Capn12	A	G	7: 28,582,285 (GRCm39)	D133G	probably benign	Het
Ccna1	A	T	3: 54,955,990 (GRCm39)	Y269N	probably damaging	Het
Cct6b	A	T	11: 82,632,239 (GRCm39)	Y250N	probably damaging	Het
Cep112	A	C	11: 108,328,061 (GRCm39)	K98Q	probably damaging	Het
Chst13	T	C	6: 90,295,251 (GRCm39)	D54G	probably damaging	Het
Clstn2	G	T	9: 97,351,872 (GRCm39)	H518N	possibly damaging	Het
Cntnap1	T	A	11: 101,073,261 (GRCm39)	L581M	probably damaging	Het
Cog3	T	A	14: 75,966,833 (GRCm39)	M446L	probably damaging	Het
Dennd2c	T	A	3: 103,068,871 (GRCm39)	I756K	probably damaging	Het
Dennd3	T	G	15: 73,404,744 (GRCm39)	L273R	probably damaging	Het
Dhx34	C	A	7: 15,952,466 (GRCm39)	R53L	probably benign	Het
Dnah9	G	A	11: 65,772,566 (GRCm39)	T3722I	probably benign	Het
Dnajb12	GC	G	10: 59,728,574 (GRCm39)		probably null	Het
Dusp6	A	G	10: 99,102,103 (GRCm39)	Y217C	probably damaging	Het
Dync2i1	T	C	12: 116,181,733 (GRCm39)	S769G	probably damaging	Het
Dyrk1b	G	A	7: 27,883,678 (GRCm39)	R178Q	possibly damaging	Het
Eif4g1	T	A	16: 20,505,645 (GRCm39)	C1009S	probably benign	Het
Frmpd1	A	T	4: 45,243,697 (GRCm39)	T57S	probably damaging	Het
Gask1a	T	C	9: 121,807,289 (GRCm39)	F478L	possibly damaging	Het
Gjc2	A	G	11: 59,068,185 (GRCm39)	V99A	possibly damaging	Het
Gm9955	A	T	18: 24,842,149 (GRCm39)		probably benign	Het
Gpr158	A	G	2: 21,831,101 (GRCm39)	I734V	possibly damaging	Het
H1f2	A	G	13: 23,923,390 (GRCm39)	S187G	probably benign	Het
Herc1	A	T	9: 66,358,401 (GRCm39)	H2494L	probably benign	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Hmgcs1	A	G	13: 120,161,351 (GRCm39)		probably null	Het
Invs	A	T	4: 48,416,084 (GRCm39)	T655S	probably benign	Het
Ipo9	G	A	1: 135,329,983 (GRCm39)	L486F	probably damaging	Het
Katnip	T	C	7: 125,453,733 (GRCm39)	V1150A	probably benign	Het
Kcnj6	A	T	16: 94,633,824 (GRCm39)	L96M	probably benign	Het
Lfng	A	G	5: 140,600,022 (GRCm39)	D354G	possibly damaging	Het
Lgsn	T	C	1: 31,235,953 (GRCm39)	L139P	probably damaging	Het
Madd	C	A	2: 90,993,890 (GRCm39)	V923L	probably damaging	Het
Mical1	A	T	10: 41,354,961 (GRCm39)	I157F	probably damaging	Het
Mis18bp1	T	C	12: 65,199,590 (GRCm39)	N154S	possibly damaging	Het
Mrps14	A	G	1: 160,023,105 (GRCm39)	K6R	probably benign	Het
Mug1	T	A	6: 121,838,032 (GRCm39)	C421S	probably damaging	Het
Myo18b	A	G	5: 113,016,161 (GRCm39)	I696T	probably damaging	Het
Naf1	T	C	8: 67,336,197 (GRCm39)	Y375H	probably damaging	Het
Nsf	T	A	11: 103,754,081 (GRCm39)	E485V	possibly damaging	Het
Nup188	A	G	2: 30,199,897 (GRCm39)	D307G	probably damaging	Het
Ocel1	C	A	8: 71,825,122 (GRCm39)	P108T	probably damaging	Het
Oip5	A	G	2: 119,443,540 (GRCm39)	S177P	probably damaging	Het
Omg	A	G	11: 79,392,584 (GRCm39)	W425R	possibly damaging	Het
Or1ad8	A	C	11: 50,898,350 (GRCm39)	I184L	possibly damaging	Het
Or1l4	A	G	2: 37,091,942 (GRCm39)	I230V	probably benign	Het
Or5an10	G	A	19: 12,276,008 (GRCm39)	Q163*	probably null	Het
Or8g26	A	C	9: 39,095,480 (GRCm39)	E2A	probably benign	Het
Polr3e	A	G	7: 120,522,172 (GRCm39)	D6G	possibly damaging	Het
Pou4f3	C	A	18: 42,528,480 (GRCm39)	P141Q	probably benign	Het
Rcsd1	T	A	1: 165,483,070 (GRCm39)	N337I	possibly damaging	Het
Rhoj	C	T	12: 75,438,486 (GRCm39)	P91S	probably damaging	Het
Rnf10	A	G	5: 115,388,057 (GRCm39)	F367S	probably damaging	Het
Rnft1	A	T	11: 86,384,022 (GRCm39)	R307S	probably benign	Het
Ryr3	A	T	2: 112,585,222 (GRCm39)	F2788Y	probably damaging	Het
Scgb1c1	A	G	7: 140,426,137 (GRCm39)	K78E	possibly damaging	Het
Scn5a	G	T	9: 119,389,352 (GRCm39)	A123E	probably damaging	Het
Setd2	T	A	9: 110,378,907 (GRCm39)	Y623*	probably null	Het
Slc49a3	A	T	5: 108,596,729 (GRCm39)	M1K	probably null	Het
Spmap2l	A	G	5: 77,164,333 (GRCm39)	D112G	possibly damaging	Het
Tbl2	C	T	5: 135,186,445 (GRCm39)	Q216*	probably null	Het
Tnc	A	G	4: 63,926,946 (GRCm39)	I860T	probably damaging	Het
Trafd1	T	C	5: 121,511,366 (GRCm39)	K484R	possibly damaging	Het
Trank1	T	C	9: 111,219,635 (GRCm39)	V2124A	probably damaging	Het
Trpm4	A	T	7: 44,959,756 (GRCm39)	W713R	probably damaging	Het
Uap1l1	T	C	2: 25,252,688 (GRCm39)	T451A	probably benign	Het
Uba6	A	T	5: 86,279,119 (GRCm39)	C668S	probably damaging	Het
Ubxn11	T	C	4: 133,853,935 (GRCm39)	F441S	probably damaging	Het
Vmn1r22	C	T	6: 57,877,723 (GRCm39)	V85M	probably damaging	Het
Vmn2r72	T	A	7: 85,401,150 (GRCm39)	I90L	probably damaging	Het
Zfp330	T	C	8: 83,491,585 (GRCm39)	E196G	probably benign	Het
Zfp746	A	G	6: 48,059,108 (GRCm39)	V167A	possibly damaging	Het
Zfp994	T	C	17: 22,420,694 (GRCm39)	E85G	possibly damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,295,231 (GRCm39)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,302,136 (GRCm39)	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65,304,443 (GRCm39)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,295,247 (GRCm39)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,302,112 (GRCm39)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,291,689 (GRCm39)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCAATCCATCTTAGGAGAAATAGC -3'
(R):5'- GAGGACATATATGCCCAAATTCAAC -3'

Sequencing Primer
(F):5'- CAAAAGTGAGATTCTTAGTCTG -3'
(R):5'- AGAGTGGAAGTGTTCTATCTATAAGG -3'

Posted On

2016-10-24