Incidental Mutation 'R5560:Tnc'
ID436506
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5560 (G1)
Quality Score210
Status Not validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64008709 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 860 (I860T)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: I860T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: I860T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107371
SMART Domains Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
Pfam:hEGF 173 185 4e-4 PFAM
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: I860T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: I860T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: I860T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: I860T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 unclassified probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7027:Tnc UTSW 4 63984589 missense probably benign 0.02
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCTTTAGTGCTATATGGGCC -3'
(R):5'- TGCTGCAAAGTCCCCACTAC -3'

Sequencing Primer
(F):5'- CTATATGGGCCTGGAGGACTC -3'
(R):5'- GCCGGCATTGACCCTTTG -3'
Posted On2016-10-24