Incidental Mutation 'R0006:Appl2'
ID43655
Institutional Source Beutler Lab
Gene Symbol Appl2
Ensembl Gene ENSMUSG00000020263
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
SynonymsDip3b
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83600033-83648738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83602898 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 556 (F556L)
Ref Sequence ENSEMBL: ENSMUSP00000020500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020500]
Predicted Effect probably damaging
Transcript: ENSMUST00000020500
AA Change: F556L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020500
Gene: ENSMUSG00000020263
AA Change: F556L

DomainStartEndE-ValueType
Pfam:BAR_3 7 248 6.4e-69 PFAM
PH 278 377 1.2e-7 SMART
Pfam:PTB 491 613 6e-7 PFAM
Pfam:PID 492 611 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150351
Predicted Effect probably benign
Transcript: ENSMUST00000176675
Predicted Effect unknown
Transcript: ENSMUST00000177187
AA Change: F2L
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele display altered red blood cell physiology. Mutant MEFs exhibit defects in HGF-induced Akt activation, migration, and invasion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Appl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Appl2 APN 10 83614301 missense possibly damaging 0.95
IGL01794:Appl2 APN 10 83614294 missense probably benign
IGL01887:Appl2 APN 10 83621522 unclassified probably benign
IGL03071:Appl2 APN 10 83641106 critical splice acceptor site probably null
IGL03077:Appl2 APN 10 83621759 unclassified probably benign
R0006:Appl2 UTSW 10 83602898 missense probably damaging 1.00
R0591:Appl2 UTSW 10 83624645 missense possibly damaging 0.94
R1695:Appl2 UTSW 10 83621582 missense probably damaging 0.99
R2217:Appl2 UTSW 10 83608737 missense possibly damaging 0.47
R2218:Appl2 UTSW 10 83608737 missense possibly damaging 0.47
R4782:Appl2 UTSW 10 83600991 missense probably damaging 1.00
R4889:Appl2 UTSW 10 83641058 missense probably damaging 1.00
R5109:Appl2 UTSW 10 83601007 missense probably benign 0.06
R5460:Appl2 UTSW 10 83602832 missense probably benign 0.00
R5512:Appl2 UTSW 10 83605818 missense probably damaging 1.00
R6023:Appl2 UTSW 10 83648529 missense probably null 0.00
R6047:Appl2 UTSW 10 83612901 critical splice acceptor site probably null
R7403:Appl2 UTSW 10 83614195 missense probably benign 0.00
X0027:Appl2 UTSW 10 83621554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGATGGACAGTGAAAACCCCAG -3'
(R):5'- TGTCAAGGGCCTGTGTAAGTACCTG -3'

Sequencing Primer
(F):5'- GGCCCTTGGAGAATAGCCTTAC -3'
(R):5'- GCCTGTGTAAGTACCTGTTACATC -3'
Posted On2013-05-29