Incidental Mutation 'R0006:Dock2'
ID43659
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0006 (G1)
Quality Score134
Status Validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 34312453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect probably benign
Transcript: ENSMUST00000093192
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157036
Predicted Effect probably benign
Transcript: ENSMUST00000165963
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTAATGGGCTGGAGATACGTTC -3'
(R):5'- GCAAGAGGAGATGCTTTGCTGCTG -3'

Sequencing Primer
(F):5'- TGCAACACACACGCTTGA -3'
(R):5'- GGGGGGGCTGTATATTTTCAAG -3'
Posted On2013-05-29