Incidental Mutation 'R5561:Dlg5'
ID436623
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Namediscs large MAGUK scaffold protein 5
Synonyms4933429D20Rik
MMRRC Submission 043118-MU
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24133953-24245920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24177792 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 354 (M354L)
Ref Sequence ENSEMBL: ENSMUSP00000087879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
Predicted Effect probably benign
Transcript: ENSMUST00000042009
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073687
AA Change: M331L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: M331L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090398
AA Change: M354L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: M354L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 intron probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGTGTTTCTAAGAAGCCC -3'
(R):5'- TGCCCTTTGGTAAACGTGG -3'

Sequencing Primer
(F):5'- TGTTTCTAAGAAGCCCACAAAGG -3'
(R):5'- GCTGAAGCACAATGGCTCATCAG -3'
Posted On2016-10-24