Incidental Mutation 'R0006:Olfr1'
ID43663
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73395488 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 178 (F178S)
Ref Sequence ENSEMBL: ENSMUSP00000113707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably damaging
Transcript: ENSMUST00000120303
AA Change: F178S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: F178S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131253
AA Change: F178S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823
AA Change: F178S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAAGACTCTTTCCAGAGCCC -3'
(R):5'- CAGAGCCAAGTTCCATCGATTCCC -3'

Sequencing Primer
(F):5'- TGACTGTCCCATAGAACAGTG -3'
(R):5'- GGTTGCCTGGCACAAATATAC -3'
Posted On2013-05-29