Incidental Mutation 'R5562:Trpm2'
ID436668
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77959939 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 118 (V118A)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105399] [ENSMUST00000105401] [ENSMUST00000219997]
Predicted Effect probably benign
Transcript: ENSMUST00000105399
SMART Domains Protein: ENSMUSP00000101038
Gene: ENSMUSG00000009292

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect possibly damaging
Transcript: ENSMUST00000105401
AA Change: V118A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: V118A

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219997
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCGTTTCCCCGTGTATAG -3'
(R):5'- AAGCCTAATGTCTCCTTTGACC -3'

Sequencing Primer
(F):5'- CGTGTATAGTGGACTCCATATACC -3'
(R):5'- GAGATGAATGTCCTGGCTCTCC -3'
Posted On2016-10-24