Incidental Mutation 'R5564:Olfr556'
ID436743
Institutional Source Beutler Lab
Gene Symbol Olfr556
Ensembl Gene ENSMUSG00000073969
Gene Nameolfactory receptor 556
SynonymsMOR41-1, GA_x6K02T2PBJ9-5386601-5387575
MMRRC Submission 043121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5564 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102664899-102673270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102670226 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 102 (F102S)
Ref Sequence ENSEMBL: ENSMUSP00000150289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098219] [ENSMUST00000213485] [ENSMUST00000217526]
Predicted Effect probably damaging
Transcript: ENSMUST00000098219
AA Change: F102S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095822
Gene: ENSMUSG00000073969
AA Change: F102S

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1.2e-85 PFAM
Pfam:7TM_GPCR_Srsx 39 192 1.5e-13 PFAM
Pfam:7tm_1 45 297 3.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213485
AA Change: F102S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217526
AA Change: F102S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,934,581 L1598M probably benign Het
Adam4 T C 12: 81,419,574 T758A probably benign Het
B3galnt2 T C 13: 13,995,229 I424T probably damaging Het
Cacna1g T C 11: 94,430,486 Y1316C probably damaging Het
Cacna2d1 T C 5: 16,312,519 S388P probably damaging Het
Ccdc157 A G 11: 4,148,765 L247S probably damaging Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Cdhr3 G T 12: 33,048,986 Y535* probably null Het
Clasp2 T C 9: 113,812,768 probably null Het
Col16a1 T A 4: 130,053,358 D165E probably damaging Het
Col9a1 A T 1: 24,195,355 probably benign Het
Cpa3 A T 3: 20,242,143 I10N possibly damaging Het
Cstf3 T A 2: 104,609,002 probably benign Het
Dnah3 C A 7: 119,971,466 probably null Het
E2f6 T C 12: 16,824,705 C263R probably benign Het
Eps8l2 C A 7: 141,356,621 Q288K possibly damaging Het
Fam193a T A 5: 34,420,855 V231D probably damaging Het
Gjc1 C T 11: 102,800,203 G325S probably benign Het
Gm5538 T C 3: 59,752,092 V322A probably benign Het
Gpatch8 T A 11: 102,538,285 E39D unknown Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Kansl3 G T 1: 36,345,964 H629N possibly damaging Het
Kcna10 C A 3: 107,194,229 H59N probably benign Het
Kitl A T 10: 100,080,024 E138D possibly damaging Het
Kpna2 T C 11: 106,990,745 K353R probably damaging Het
M1ap T A 6: 82,981,817 I143N probably damaging Het
Macf1 A G 4: 123,526,745 S239P possibly damaging Het
Med13l T A 5: 118,742,040 S1066T probably damaging Het
Mettl23 G T 11: 116,849,039 E47* probably null Het
Olfr312 C T 11: 58,831,213 Q20* probably null Het
Proca1 T A 11: 78,201,873 D48E possibly damaging Het
Rab34 T G 11: 78,191,632 V227G probably damaging Het
Rab7 A T 6: 88,013,650 L14Q probably damaging Het
Rasgef1c C T 11: 49,957,107 S23F probably benign Het
Rit1 A G 3: 88,726,150 probably benign Het
Scin T C 12: 40,124,569 T172A probably benign Het
Scmh1 C A 4: 120,468,378 N97K probably damaging Het
Skint6 T C 4: 112,988,965 E655G possibly damaging Het
Slc22a15 A G 3: 101,864,589 V243A probably benign Het
Smg1 A G 7: 118,189,819 probably benign Het
Smim7 C T 8: 72,571,023 G3R probably damaging Het
Snurf C T 7: 59,995,534 R44H possibly damaging Het
Snx13 G A 12: 35,124,472 A667T possibly damaging Het
Sowaha T G 11: 53,478,763 H382P probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem259 G T 10: 79,978,608 probably null Het
Topbp1 A G 9: 103,334,078 T945A probably damaging Het
Tor1aip2 T C 1: 156,063,561 probably benign Het
Ube3b T C 5: 114,389,075 V118A probably damaging Het
Usp38 T C 8: 80,985,088 K773E probably damaging Het
Wnk1 G A 6: 119,948,891 probably benign Het
Zfp871 A G 17: 32,775,868 V111A possibly damaging Het
Other mutations in Olfr556
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr556 APN 7 102670651 missense probably damaging 1.00
IGL01662:Olfr556 APN 7 102670720 missense probably damaging 1.00
IGL02989:Olfr556 APN 7 102670444 missense possibly damaging 0.50
R0194:Olfr556 UTSW 7 102670199 missense probably benign 0.01
R1670:Olfr556 UTSW 7 102670402 missense possibly damaging 0.72
R1680:Olfr556 UTSW 7 102670733 missense possibly damaging 0.82
R1711:Olfr556 UTSW 7 102670162 missense probably damaging 0.98
R1768:Olfr556 UTSW 7 102670301 missense probably damaging 1.00
R1950:Olfr556 UTSW 7 102670477 missense probably benign 0.03
R4452:Olfr556 UTSW 7 102670049 missense probably benign 0.00
R6623:Olfr556 UTSW 7 102670034 missense possibly damaging 0.90
R7040:Olfr556 UTSW 7 102670730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATCTCACTGAGTACCATG -3'
(R):5'- CTACATTGGAGGCACAAAATGG -3'

Sequencing Primer
(F):5'- GCCATCTCACTGAGTACCATGTATAG -3'
(R):5'- TGGCAAATGACTCAACATCCAACTC -3'
Posted On2016-10-24