Incidental Mutation 'R5566:Adamts4'
List |< first << previous [record 54 of 1308] next >> last >|
ID436778
Institutional Source Beutler Lab
Gene Symbol Adamts4
Ensembl Gene ENSMUSG00000006403
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonymsaggrecanase-1, ADAM-TS4
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5566 (G1)
Quality Score169
Status Not validated
Chromosome1
Chromosomal Location171250421-171260637 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 171250850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000106947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013737] [ENSMUST00000111314] [ENSMUST00000111315] [ENSMUST00000111318] [ENSMUST00000191871] [ENSMUST00000194778] [ENSMUST00000219033]
Predicted Effect probably benign
Transcript: ENSMUST00000013737
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111314
SMART Domains Protein: ENSMUSP00000106946
Gene: ENSMUSG00000006403

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Reprolysin_5 27 214 1.8e-12 PFAM
Pfam:Reprolysin 29 239 1e-19 PFAM
Pfam:Reprolysin_4 33 235 1.2e-10 PFAM
Pfam:Reprolysin_3 50 183 5.4e-12 PFAM
Pfam:Reprolysin_2 50 229 1.9e-9 PFAM
Blast:ACR 240 319 4e-24 BLAST
TSP1 334 386 3.52e-14 SMART
Pfam:ADAM_spacer1 497 614 5.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111315
AA Change: M1K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106947
Gene: ENSMUSG00000006403
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Pep_M12B_propep 54 177 5.6e-17 PFAM
Pfam:Reprolysin_5 212 399 6.5e-12 PFAM
Pfam:Reprolysin 214 424 4.6e-19 PFAM
Pfam:Reprolysin_4 219 420 4.6e-10 PFAM
Pfam:Reprolysin_3 235 368 1.9e-11 PFAM
Pfam:Reprolysin_2 236 414 7.2e-9 PFAM
Blast:ACR 425 504 4e-24 BLAST
TSP1 519 571 3.52e-14 SMART
Pfam:ADAM_spacer1 682 799 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111318
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136976
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219033
AA Change: M13K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active zinc-dependent aggrecanase enzyme that degrades cartilage. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological abnormalities. However, they do display impaired coordination and an increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M28K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Adamts4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Adamts4 APN 1 171252850 missense probably damaging 1.00
IGL02496:Adamts4 APN 1 171250943 missense probably benign 0.00
IGL02510:Adamts4 APN 1 171251390 missense probably benign 0.08
IGL02695:Adamts4 APN 1 171252634 missense probably damaging 1.00
IGL02952:Adamts4 APN 1 171251348 missense probably damaging 1.00
IGL03010:Adamts4 APN 1 171251416 missense probably damaging 1.00
IGL03304:Adamts4 APN 1 171252869 splice site probably benign
R0331:Adamts4 UTSW 1 171250972 missense probably benign 0.00
R1302:Adamts4 UTSW 1 171253183 missense probably damaging 1.00
R1460:Adamts4 UTSW 1 171256440 splice site probably benign
R1502:Adamts4 UTSW 1 171258990 missense probably damaging 1.00
R1544:Adamts4 UTSW 1 171252742 missense probably benign 0.09
R1815:Adamts4 UTSW 1 171256336 missense probably damaging 0.99
R1982:Adamts4 UTSW 1 171258934 missense probably benign 0.00
R1986:Adamts4 UTSW 1 171256675 missense possibly damaging 0.94
R2281:Adamts4 UTSW 1 171256229 missense probably damaging 1.00
R4261:Adamts4 UTSW 1 171259104 missense probably benign 0.01
R4750:Adamts4 UTSW 1 171251066 missense probably benign
R4868:Adamts4 UTSW 1 171252431 intron probably benign
R4924:Adamts4 UTSW 1 171259074 missense probably damaging 0.97
R5418:Adamts4 UTSW 1 171252574 missense probably damaging 1.00
R5468:Adamts4 UTSW 1 171252609 missense probably benign
R5781:Adamts4 UTSW 1 171251015 missense possibly damaging 0.89
R6043:Adamts4 UTSW 1 171252601 missense probably damaging 1.00
R6053:Adamts4 UTSW 1 171252715 missense possibly damaging 0.85
R6187:Adamts4 UTSW 1 171250993 missense probably damaging 1.00
R6614:Adamts4 UTSW 1 171256624 missense probably benign 0.07
X0062:Adamts4 UTSW 1 171256549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCCGTGGGCACTTTTC -3'
(R):5'- CCATTGAGCTTCTCTGGAAACAC -3'

Sequencing Primer
(F):5'- CCGTGGGCACTTTTCCTGAG -3'
(R):5'- GAGCTTCTCTGGAAACACGATCTC -3'
Posted On2016-10-24