Incidental Mutation 'R5567:Hs6st1'
ID436884
Institutional Source Beutler Lab
Gene Symbol Hs6st1
Ensembl Gene ENSMUSG00000045216
Gene Nameheparan sulfate 6-O-sulfotransferase 1
Synonyms6OST1
MMRRC Submission 043124-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36068400-36106446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36103638 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 218 (P218L)
Ref Sequence ENSEMBL: ENSMUSP00000085499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088174]
Predicted Effect probably benign
Transcript: ENSMUST00000088174
AA Change: P218L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085499
Gene: ENSMUSG00000045216
AA Change: P218L

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
Pfam:Sulfotransfer_2 79 351 2e-79 PFAM
coiled coil region 352 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194670
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show prenatal loss, stunted growth, dilated alveoli and lower postweaning survival. Homozygotes for another null allele show additional defects in placenta, eye, phalanx and tarsus morphology. Homozygotes for a gene trapallele show altered retinal axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Hs6st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Hs6st1 APN 1 36103704 missense probably damaging 0.98
IGL01721:Hs6st1 APN 1 36068935 missense probably damaging 1.00
IGL02123:Hs6st1 APN 1 36103871 missense possibly damaging 0.84
IGL02498:Hs6st1 APN 1 36103740 missense probably damaging 1.00
IGL02662:Hs6st1 APN 1 36103812 nonsense probably null
IGL02730:Hs6st1 APN 1 36103628 missense probably damaging 1.00
R0359:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R0360:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R1268:Hs6st1 UTSW 1 36068926 missense probably damaging 1.00
R1355:Hs6st1 UTSW 1 36103576 missense probably damaging 1.00
R1521:Hs6st1 UTSW 1 36068886 missense probably damaging 0.99
R1942:Hs6st1 UTSW 1 36068722 missense probably benign
R2364:Hs6st1 UTSW 1 36068719 missense probably benign 0.05
R4418:Hs6st1 UTSW 1 36104027 missense probably damaging 1.00
R4570:Hs6st1 UTSW 1 36103547 missense possibly damaging 0.84
R5319:Hs6st1 UTSW 1 36104178 missense probably benign 0.01
R5370:Hs6st1 UTSW 1 36069081 missense probably damaging 0.99
R5570:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5668:Hs6st1 UTSW 1 36103889 missense probably damaging 0.98
R6966:Hs6st1 UTSW 1 36104218 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTAGTCACCACAGTGG -3'
(R):5'- CCGCTCAAATAGGTACTGCG -3'

Sequencing Primer
(F):5'- TAGTCACCACAGTGGGTGCAG -3'
(R):5'- CAAATAGGTACTGCGTCTTGC -3'
Posted On2016-10-24