Incidental Mutation 'R5567:Rpl31'
ID436885
Institutional Source Beutler Lab
Gene Symbol Rpl31
Ensembl Gene ENSMUSG00000073702
Gene Nameribosomal protein L31
Synonyms
MMRRC Submission 043124-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location39367842-39371911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39370027 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 41 (R41C)
Ref Sequence ENSEMBL: ENSMUSP00000141808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000086535] [ENSMUST00000178079] [ENSMUST00000179954] [ENSMUST00000192531] [ENSMUST00000193823] [ENSMUST00000194746] [ENSMUST00000195123]
Predicted Effect probably benign
Transcript: ENSMUST00000054462
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086535
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083722
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178079
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136354
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179954
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137631
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191855
Predicted Effect probably benign
Transcript: ENSMUST00000192099
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193823
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194746
AA Change: R41C

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141808
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-40 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195123
AA Change: R41C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142039
Gene: ENSMUSG00000073702
AA Change: R41C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 83 7.9e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Carriers of dominant spontaneous mutations have a shortened, kinked tail with variable expessivity in the tail length and number of kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Rpl31
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4838:Rpl31 UTSW 1 39370967 missense probably benign 0.03
R5566:Rpl31 UTSW 1 39370027 missense probably benign 0.05
R5570:Rpl31 UTSW 1 39370027 missense probably benign 0.05
R5580:Rpl31 UTSW 1 39370027 missense probably benign 0.05
R5644:Rpl31 UTSW 1 39370027 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATAGGATGCTTGGAATTTACCCC -3'
(R):5'- CCTGAGGCATTGTCCCAGTATC -3'

Sequencing Primer
(F):5'- CCCTACATCTTAAGTACTGATGCTAG -3'
(R):5'- CTGCTAACTGAACTCTCAAATGTGAC -3'
Posted On2016-10-24