Incidental Mutation 'R5567:Plxna4'
ID436912
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission 043124-MU
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32157980 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1763 (N1763D)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115096
AA Change: N1763D

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: N1763D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGGACTTTCTGTTCCAGAC -3'
(R):5'- TTCCCACAGCAGTCACAGATG -3'

Sequencing Primer
(F):5'- TGTTCCAGACAGACACCCTCAG -3'
(R):5'- GCAGTCACAGATGGTTTCTAAGCTC -3'
Posted On2016-10-24