Incidental Mutation 'R5567:Aak1'
ID436913
Institutional Source Beutler Lab
Gene Symbol Aak1
Ensembl Gene ENSMUSG00000057230
Gene NameAP2 associated kinase 1
Synonyms5530400K14Rik, D6Ertd245e
MMRRC Submission 043124-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86849517-87003223 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 86955168 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 374 (Q374*)
Ref Sequence ENSEMBL: ENSMUSP00000086948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003710] [ENSMUST00000089519]
Predicted Effect probably null
Transcript: ENSMUST00000003710
AA Change: Q374*
SMART Domains Protein: ENSMUSP00000003710
Gene: ENSMUSG00000057230
AA Change: Q374*

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1.5e-27 PFAM
Pfam:Pkinase 46 312 7e-43 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 527 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 712 730 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089519
AA Change: Q374*
SMART Domains Protein: ENSMUSP00000086948
Gene: ENSMUSG00000057230
AA Change: Q374*

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1e-26 PFAM
Pfam:Pkinase 46 312 2.2e-44 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 510 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 608 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 716 728 N/A INTRINSIC
low complexity region 793 811 N/A INTRINSIC
low complexity region 929 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113668
SMART Domains Protein: ENSMUSP00000109298
Gene: ENSMUSG00000057230

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 3.5e-28 PFAM
Pfam:Pkinase 46 312 1.7e-43 PFAM
Pfam:Kinase-like 126 301 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204613
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Aak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Aak1 APN 6 86946153 missense probably damaging 1.00
IGL01284:Aak1 APN 6 86850053 start codon destroyed possibly damaging 0.86
IGL01292:Aak1 APN 6 86949538 splice site probably benign
IGL01344:Aak1 APN 6 86946157 missense possibly damaging 0.49
IGL02317:Aak1 APN 6 86956300 missense possibly damaging 0.61
IGL02422:Aak1 APN 6 86982616 missense unknown
IGL02531:Aak1 APN 6 86956447 missense unknown
IGL02719:Aak1 APN 6 86959170 intron probably benign
IGL03051:Aak1 APN 6 86987301 utr 3 prime probably benign
R0382:Aak1 UTSW 6 86946919 missense probably benign 0.19
R0846:Aak1 UTSW 6 86959089 intron probably benign
R1074:Aak1 UTSW 6 86935439 missense probably damaging 0.97
R1141:Aak1 UTSW 6 86965476 critical splice acceptor site probably null
R1221:Aak1 UTSW 6 86965478 missense unknown
R1261:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1262:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1470:Aak1 UTSW 6 86967355 missense unknown
R1470:Aak1 UTSW 6 86967355 missense unknown
R1931:Aak1 UTSW 6 86956336 missense unknown
R3713:Aak1 UTSW 6 86955190 missense probably benign 0.19
R3785:Aak1 UTSW 6 86965578 missense unknown
R3815:Aak1 UTSW 6 86959042 intron probably benign
R3816:Aak1 UTSW 6 86959042 intron probably benign
R3819:Aak1 UTSW 6 86959042 intron probably benign
R4165:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4166:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4351:Aak1 UTSW 6 86935537 splice site probably null
R4430:Aak1 UTSW 6 86986366 missense unknown
R4431:Aak1 UTSW 6 86986318 missense unknown
R4665:Aak1 UTSW 6 86925077 missense probably null 1.00
R4821:Aak1 UTSW 6 86850189 missense probably damaging 1.00
R5088:Aak1 UTSW 6 86944480 critical splice donor site probably null
R5543:Aak1 UTSW 6 86982645 critical splice donor site probably null
R5726:Aak1 UTSW 6 86925124 nonsense probably null
R6083:Aak1 UTSW 6 86963996 missense unknown
R6269:Aak1 UTSW 6 86964051 missense unknown
R6693:Aak1 UTSW 6 86965515 missense unknown
R6700:Aak1 UTSW 6 86964203 missense unknown
R6759:Aak1 UTSW 6 86944417 missense probably damaging 1.00
R6969:Aak1 UTSW 6 86981335 missense unknown
Y4335:Aak1 UTSW 6 86959142 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGAATGTTTTGGAGGCG -3'
(R):5'- GTGATCCACCCGAGTACAGAAAG -3'

Sequencing Primer
(F):5'- CGTGTTAAGGGCAGACATCTTG -3'
(R):5'- GAAAGAAGTTCTTCCTTGTACTGCC -3'
Posted On2016-10-24