Incidental Mutation 'R5567:Myo16'
ID436925
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 043124-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R5567 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10322676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 125 (D125G)
Ref Sequence ENSEMBL: ENSMUSP00000049345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477] [ENSMUST00000208309] [ENSMUST00000214643]
Predicted Effect probably damaging
Transcript: ENSMUST00000042103
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: D125G

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: D125G
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: D125G
Predicted Effect probably damaging
Transcript: ENSMUST00000208309
AA Change: D125G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214643
AA Change: D147G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Parl A G 16: 20,283,012 M90T probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTCCCCATCAGCCTGAC -3'
(R):5'- TGATGCAGACACATGCTTTCC -3'

Sequencing Primer
(F):5'- CCTTAGTCTCATTGGGGACAGAGAAC -3'
(R):5'- CCCCCAAAGTAGTGTGATACATTGAG -3'
Posted On2016-10-24