Incidental Mutation 'R0046:Pclo'
ID43696
Institutional Source Beutler Lab
Gene Symbol Pclo
Ensembl Gene ENSMUSG00000061601
Gene Namepiccolo (presynaptic cytomatrix protein)
SynonymsAcz, Pico
MMRRC Submission 038340-MU
Accession Numbers

Ncbi RefSeq: NM_011995.4; NM_001110796.1; MGI:1349390

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location14514918-14863459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14540479 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 931 (T931M)
Ref Sequence ENSEMBL: ENSMUSP00000138419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030691] [ENSMUST00000182407]
Predicted Effect unknown
Transcript: ENSMUST00000030691
AA Change: T931M
SMART Domains Protein: ENSMUSP00000030691
Gene: ENSMUSG00000061601
AA Change: T931M

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.23e-13 PROSPERO
internal_repeat_2 305 389 1.23e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 530 589 5.2e-30 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 995 1053 6.7e-33 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_4 1196 1249 1.65e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_4 3473 3521 1.65e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
low complexity region 4870 4892 N/A INTRINSIC
C2 4951 5057 8.56e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182407
AA Change: T931M
SMART Domains Protein: ENSMUSP00000138419
Gene: ENSMUSG00000061601
AA Change: T931M

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.06e-13 PROSPERO
internal_repeat_2 305 389 1.06e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 528 589 3e-36 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 993 1053 4.3e-37 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_3 1196 1249 1.46e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_3 3473 3521 1.46e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182496
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype Strain: 3699630; 4442915; 4442914
Lethality: D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the presynaptic cytoskeletal matrix, which is involved in establishing active synaptic zones and in synaptic vesicle trafficking. Variations in this gene have been associated with bipolar disorder and major depressive disorder. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for one deletion of Pclo are viable and fertile, and display no overt abnormal phenotype. Mice homozygous for another knock-out allele exhibit some premature lethality, decreased body size, and abnormal synaptic vesicle number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Pclo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Pclo APN 5 14521677 nonsense probably null
IGL00429:Pclo APN 5 14680739 unclassified probably benign
IGL00498:Pclo APN 5 14540739 missense unknown
IGL00528:Pclo APN 5 14676434 unclassified probably benign
IGL00743:Pclo APN 5 14678021 unclassified probably benign
IGL00809:Pclo APN 5 14675797 missense unknown
IGL00811:Pclo APN 5 14680010 unclassified probably benign
IGL00819:Pclo APN 5 14858846 missense unknown
IGL00870:Pclo APN 5 14539983 missense unknown
IGL00925:Pclo APN 5 14766741 missense unknown
IGL00960:Pclo APN 5 14675220 missense unknown
IGL01013:Pclo APN 5 14793834 missense unknown
IGL01112:Pclo APN 5 14681069 missense unknown
IGL01124:Pclo APN 5 14714329 missense unknown
IGL01150:Pclo APN 5 14676912 unclassified probably benign
IGL01302:Pclo APN 5 14675999 unclassified probably benign
IGL01389:Pclo APN 5 14714521 missense probably damaging 0.99
IGL01448:Pclo APN 5 14676394 unclassified probably benign
IGL01449:Pclo APN 5 14678516 unclassified probably benign
IGL01450:Pclo APN 5 14677193 unclassified probably benign
IGL01476:Pclo APN 5 14521108 missense probably damaging 1.00
IGL01537:Pclo APN 5 14539633 missense unknown
IGL01568:Pclo APN 5 14678429 unclassified probably benign
IGL01574:Pclo APN 5 14713448 missense unknown
IGL01637:Pclo APN 5 14540034 missense unknown
IGL01646:Pclo APN 5 14713867 missense unknown
IGL01672:Pclo APN 5 14678535 unclassified probably benign
IGL01705:Pclo APN 5 14677865 unclassified probably benign
IGL02127:Pclo APN 5 14765145 splice site probably benign
IGL02215:Pclo APN 5 14856985 missense unknown
IGL02271:Pclo APN 5 14679494 unclassified probably benign
IGL02300:Pclo APN 5 14713741 missense unknown
IGL02346:Pclo APN 5 14677538 unclassified probably benign
IGL02449:Pclo APN 5 14515343 missense probably damaging 1.00
IGL02452:Pclo APN 5 14676966 unclassified probably benign
IGL02455:Pclo APN 5 14540175 missense unknown
IGL02478:Pclo APN 5 14766778 missense unknown
IGL02677:Pclo APN 5 14676929 unclassified probably benign
IGL02711:Pclo APN 5 14522308 missense unknown
IGL02737:Pclo APN 5 14714163 missense unknown
IGL02943:Pclo APN 5 14669221 missense unknown
IGL03184:Pclo APN 5 14714443 missense probably damaging 1.00
IGL03246:Pclo APN 5 14677617 unclassified probably benign
IGL03263:Pclo APN 5 14681810 missense unknown
IGL03300:Pclo APN 5 14712798 missense unknown
IGL03399:Pclo APN 5 14766731 missense unknown
Gauche UTSW 5 14793855 missense unknown
P0018:Pclo UTSW 5 14677721 unclassified probably benign
R0014:Pclo UTSW 5 14680451 unclassified probably benign
R0014:Pclo UTSW 5 14680451 unclassified probably benign
R0020:Pclo UTSW 5 14669673 missense unknown
R0045:Pclo UTSW 5 14539471 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0128:Pclo UTSW 5 14679797 unclassified probably benign
R0130:Pclo UTSW 5 14679797 unclassified probably benign
R0141:Pclo UTSW 5 14791922 missense unknown
R0226:Pclo UTSW 5 14765223 missense probably damaging 0.99
R0243:Pclo UTSW 5 14775420 missense unknown
R0267:Pclo UTSW 5 14681180 missense unknown
R0313:Pclo UTSW 5 14678873 unclassified probably benign
R0324:Pclo UTSW 5 14669433 missense unknown
R0331:Pclo UTSW 5 14680376 unclassified probably benign
R0370:Pclo UTSW 5 14521090 missense probably damaging 1.00
R0398:Pclo UTSW 5 14681702 missense unknown
R0401:Pclo UTSW 5 14681734 missense unknown
R0417:Pclo UTSW 5 14713022 missense unknown
R0468:Pclo UTSW 5 14677288 unclassified probably benign
R0472:Pclo UTSW 5 14681594 missense unknown
R0488:Pclo UTSW 5 14669299 missense unknown
R0511:Pclo UTSW 5 14678285 unclassified probably benign
R0511:Pclo UTSW 5 14679398 unclassified probably benign
R0520:Pclo UTSW 5 14713830 nonsense probably null
R0547:Pclo UTSW 5 14792072 missense unknown
R0611:Pclo UTSW 5 14678775 unclassified probably benign
R0611:Pclo UTSW 5 14712814 missense unknown
R0624:Pclo UTSW 5 14669656 missense unknown
R0628:Pclo UTSW 5 14669538 missense unknown
R0639:Pclo UTSW 5 14681749 nonsense probably null
R0653:Pclo UTSW 5 14682255 intron probably benign
R0681:Pclo UTSW 5 14675318 missense unknown
R0689:Pclo UTSW 5 14714019 missense unknown
R0698:Pclo UTSW 5 14712516 missense unknown
R0737:Pclo UTSW 5 14515439 missense probably damaging 1.00
R0883:Pclo UTSW 5 14677859 nonsense probably null
R0906:Pclo UTSW 5 14676686 unclassified probably benign
R1056:Pclo UTSW 5 14540055 nonsense probably null
R1107:Pclo UTSW 5 14677869 unclassified probably benign
R1174:Pclo UTSW 5 14677646 unclassified probably benign
R1184:Pclo UTSW 5 14522262 missense unknown
R1302:Pclo UTSW 5 14681633 missense unknown
R1318:Pclo UTSW 5 14679314 unclassified probably benign
R1342:Pclo UTSW 5 14682177 intron probably benign
R1378:Pclo UTSW 5 14682313 missense probably benign 0.23
R1418:Pclo UTSW 5 14678130 unclassified probably benign
R1471:Pclo UTSW 5 14680427 unclassified probably benign
R1485:Pclo UTSW 5 14713779 missense unknown
R1523:Pclo UTSW 5 14788406 missense unknown
R1527:Pclo UTSW 5 14679648 unclassified probably benign
R1531:Pclo UTSW 5 14521903 missense probably damaging 0.99
R1537:Pclo UTSW 5 14712475 missense unknown
R1574:Pclo UTSW 5 14679831 unclassified probably benign
R1574:Pclo UTSW 5 14679831 unclassified probably benign
R1581:Pclo UTSW 5 14521282 missense probably benign 0.28
R1613:Pclo UTSW 5 14679132 unclassified probably benign
R1632:Pclo UTSW 5 14680003 unclassified probably benign
R1688:Pclo UTSW 5 14788493 critical splice donor site probably null
R1694:Pclo UTSW 5 14520963 missense probably damaging 1.00
R1707:Pclo UTSW 5 14713224 missense unknown
R1727:Pclo UTSW 5 14676987 unclassified probably benign
R1741:Pclo UTSW 5 14676510 unclassified probably benign
R1853:Pclo UTSW 5 14676684 unclassified probably benign
R1856:Pclo UTSW 5 14778552 missense probably damaging 1.00
R1907:Pclo UTSW 5 14678511 unclassified probably benign
R1970:Pclo UTSW 5 14713473 missense unknown
R1971:Pclo UTSW 5 14713473 missense unknown
R1973:Pclo UTSW 5 14676059 unclassified probably null
R1978:Pclo UTSW 5 14713795 missense unknown
R1999:Pclo UTSW 5 14677080 unclassified probably benign
R2015:Pclo UTSW 5 14521501 missense probably damaging 0.98
R2084:Pclo UTSW 5 14682148 missense probably benign 0.23
R2144:Pclo UTSW 5 14858752 missense unknown
R2155:Pclo UTSW 5 14714295 missense probably benign 0.02
R2191:Pclo UTSW 5 14713848 missense unknown
R2237:Pclo UTSW 5 14713938 missense unknown
R2276:Pclo UTSW 5 14714273 missense unknown
R2279:Pclo UTSW 5 14714273 missense unknown
R2281:Pclo UTSW 5 14540332 missense unknown
R2307:Pclo UTSW 5 14678651 unclassified probably benign
R2386:Pclo UTSW 5 14765247 missense unknown
R2407:Pclo UTSW 5 14678932 unclassified probably benign
R2512:Pclo UTSW 5 14712598 missense unknown
R2889:Pclo UTSW 5 14856981 missense unknown
R2966:Pclo UTSW 5 14681150 missense unknown
R3151:Pclo UTSW 5 14521678 missense probably damaging 0.99
R3424:Pclo UTSW 5 14680418 unclassified probably benign
R3687:Pclo UTSW 5 14668995 missense unknown
R3719:Pclo UTSW 5 14521161 missense probably benign 0.33
R3739:Pclo UTSW 5 14680899 missense unknown
R3745:Pclo UTSW 5 14678421 unclassified probably benign
R3771:Pclo UTSW 5 14539408 critical splice acceptor site probably null
R3789:Pclo UTSW 5 14680450 unclassified probably benign
R3803:Pclo UTSW 5 14515402 nonsense probably null
R3902:Pclo UTSW 5 14712522 missense probably benign 0.01
R3942:Pclo UTSW 5 14679918 unclassified probably benign
R4061:Pclo UTSW 5 14540566 missense unknown
R4094:Pclo UTSW 5 14855645 missense unknown
R4175:Pclo UTSW 5 14713875 missense probably damaging 0.99
R4195:Pclo UTSW 5 14677563 unclassified probably benign
R4398:Pclo UTSW 5 14775366 missense probably damaging 1.00
R4429:Pclo UTSW 5 14678100 unclassified probably benign
R4523:Pclo UTSW 5 14679992 unclassified probably benign
R4531:Pclo UTSW 5 14775408 missense unknown
R4552:Pclo UTSW 5 14669271 missense unknown
R4563:Pclo UTSW 5 14521369 missense probably damaging 1.00
R4581:Pclo UTSW 5 14675505 missense unknown
R4638:Pclo UTSW 5 14680433 nonsense probably null
R4655:Pclo UTSW 5 14682383 intron probably benign
R4703:Pclo UTSW 5 14676480 unclassified probably benign
R4704:Pclo UTSW 5 14676480 unclassified probably benign
R4705:Pclo UTSW 5 14676480 unclassified probably benign
R4706:Pclo UTSW 5 14714207 missense unknown
R4709:Pclo UTSW 5 14778558 missense unknown
R4755:Pclo UTSW 5 14714348 missense unknown
R4786:Pclo UTSW 5 14723267 missense unknown
R4801:Pclo UTSW 5 14675815 missense unknown
R4802:Pclo UTSW 5 14675815 missense unknown
R4812:Pclo UTSW 5 14540025 missense unknown
R4817:Pclo UTSW 5 14675031 missense unknown
R4817:Pclo UTSW 5 14713125 missense unknown
R4845:Pclo UTSW 5 14679118 unclassified probably benign
R4876:Pclo UTSW 5 14811680 missense unknown
R4907:Pclo UTSW 5 14680051 unclassified probably benign
R4943:Pclo UTSW 5 14712637 missense unknown
R4963:Pclo UTSW 5 14669221 missense unknown
R4970:Pclo UTSW 5 14677882 unclassified probably benign
R4978:Pclo UTSW 5 14714478 missense probably benign 0.23
R4982:Pclo UTSW 5 14679294 unclassified probably benign
R5019:Pclo UTSW 5 14714367 missense unknown
R5068:Pclo UTSW 5 14679073 unclassified probably benign
R5092:Pclo UTSW 5 14677308 unclassified probably benign
R5112:Pclo UTSW 5 14677882 unclassified probably benign
R5124:Pclo UTSW 5 14677392 unclassified probably benign
R5210:Pclo UTSW 5 14713450 missense probably damaging 0.99
R5227:Pclo UTSW 5 14713560 missense probably benign 0.23
R5264:Pclo UTSW 5 14676923 unclassified probably benign
R5280:Pclo UTSW 5 14540717 missense unknown
R5286:Pclo UTSW 5 14679747 unclassified probably benign
R5297:Pclo UTSW 5 14676249 unclassified probably benign
R5344:Pclo UTSW 5 14676612 unclassified probably benign
R5354:Pclo UTSW 5 14678808 unclassified probably benign
R5358:Pclo UTSW 5 14712736 nonsense probably null
R5363:Pclo UTSW 5 14669410 missense unknown
R5377:Pclo UTSW 5 14681353 missense unknown
R5457:Pclo UTSW 5 14676143 unclassified probably benign
R5468:Pclo UTSW 5 14680952 missense unknown
R5588:Pclo UTSW 5 14788398 missense unknown
R5836:Pclo UTSW 5 14678535 unclassified probably benign
R5865:Pclo UTSW 5 14714478 missense probably benign 0.23
R5875:Pclo UTSW 5 14680600 unclassified probably benign
R5892:Pclo UTSW 5 14521171 missense probably damaging 1.00
R5905:Pclo UTSW 5 14680385 unclassified probably benign
R5967:Pclo UTSW 5 14540655 missense unknown
R6046:Pclo UTSW 5 14713288 missense unknown
R6059:Pclo UTSW 5 14811700 missense unknown
R6092:Pclo UTSW 5 14677923 unclassified probably benign
R6119:Pclo UTSW 5 14677019 unclassified probably benign
R6221:Pclo UTSW 5 14675313 missense unknown
R6243:Pclo UTSW 5 14676443 unclassified probably benign
R6269:Pclo UTSW 5 14522094 nonsense probably null
R6303:Pclo UTSW 5 14677893 unclassified probably benign
R6304:Pclo UTSW 5 14677893 unclassified probably benign
R6453:Pclo UTSW 5 14676789 unclassified probably benign
R6460:Pclo UTSW 5 14679132 unclassified probably benign
R6497:Pclo UTSW 5 14793855 missense unknown
R6498:Pclo UTSW 5 14669491 missense unknown
R6524:Pclo UTSW 5 14718869 missense unknown
R6682:Pclo UTSW 5 14539879 missense unknown
R6823:Pclo UTSW 5 14677907 unclassified probably benign
R6830:Pclo UTSW 5 14681099 missense unknown
R6831:Pclo UTSW 5 14788429 nonsense probably null
R6965:Pclo UTSW 5 14681962 intron probably benign
X0058:Pclo UTSW 5 14682131 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCTCAAGAAACTGTGACAGGGAAGC -3'
(R):5'- GGGCGTTGGGTTAAATCCACAGAG -3'

Sequencing Primer
(F):5'- CTGTGACAGGGAAGCTATTCG -3'
(R):5'- ATCCTGAGACCCTACGTTGAG -3'
Posted On2013-05-29