Incidental Mutation 'R5567:Parl'
ID436963
Institutional Source Beutler Lab
Gene Symbol Parl
Ensembl Gene ENSMUSG00000033918
Gene Namepresenilin associated, rhomboid-like
SynonymsD16Ertd607e, PSENIP2, PRO2207, PSARL1, Psarl
MMRRC Submission 043124-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5567 (G1)
Quality Score200
Status Not validated
Chromosome16
Chromosomal Location20279818-20302387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20283012 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 90 (M90T)
Ref Sequence ENSEMBL: ENSMUSP00000155904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048642] [ENSMUST00000133153] [ENSMUST00000136252] [ENSMUST00000152887] [ENSMUST00000232036] [ENSMUST00000232484]
Predicted Effect probably damaging
Transcript: ENSMUST00000048642
AA Change: M279T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045361
Gene: ENSMUSG00000033918
AA Change: M279T

DomainStartEndE-ValueType
transmembrane domain 100 119 N/A INTRINSIC
transmembrane domain 166 185 N/A INTRINSIC
Pfam:Rhomboid 199 351 9.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126001
Predicted Effect probably benign
Transcript: ENSMUST00000133153
Predicted Effect probably benign
Transcript: ENSMUST00000136252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136700
Predicted Effect probably damaging
Transcript: ENSMUST00000152887
AA Change: M90T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155832
Predicted Effect probably benign
Transcript: ENSMUST00000231547
Predicted Effect probably benign
Transcript: ENSMUST00000232036
Predicted Effect probably benign
Transcript: ENSMUST00000232484
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhomboid family of intramembrane serine proteases that is localized to the inner mitochondrial membrane. The encoded protein regulates mitochondrial remodeling and apoptosis through regulated substrate proteolysis. Proteolytic processing of the encoded protein results in the release of a small peptide, P-beta, which may transit to the nucleus. Mutations in this gene may be associated with Parkinson's disease. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice show stunted growth, lymphocyte and neuron apoptosis, faster apoptotic cristae remodeling and cytochrome c release from mitochondria, dyspnea, cryptorchism, reduced testes and epididymi, kyphosis and premature death due to progressive cachexia sustained by multisystemic atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 C T 6: 86,955,168 Q374* probably null Het
Adam19 A G 11: 46,136,250 D570G probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cdh9 A G 15: 16,855,844 T657A probably damaging Het
Cep104 T C 4: 154,002,277 S794P possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Csmd3 A T 15: 47,645,468 M2907K possibly damaging Het
Cspg4 A C 9: 56,886,648 I556L probably benign Het
Cwf19l2 T A 9: 3,456,831 D721E probably damaging Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dna2 G T 10: 62,966,673 A857S possibly damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Flnc T A 6: 29,444,045 C619* probably null Het
Ftcd A G 10: 76,588,133 K503E probably benign Het
Gbp2b C T 3: 142,611,365 A494V possibly damaging Het
Gfral C T 9: 76,208,618 A25T probably benign Het
Gins2 T A 8: 120,588,945 D24V possibly damaging Het
Gm10985 T C 3: 53,845,262 I22T probably damaging Het
Gm9992 T C 17: 7,363,803 T456A probably benign Het
Golga4 T A 9: 118,558,183 S1458T probably damaging Het
Gpatch1 T C 7: 35,307,215 K176R probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Itpr3 C T 17: 27,103,906 T1119M possibly damaging Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Klk1b1 T A 7: 43,971,169 S228T probably damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Large1 A G 8: 72,837,453 S562P possibly damaging Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Lrriq1 G A 10: 103,170,596 P1223S possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Morn2 A G 17: 80,297,280 D128G probably damaging Het
Msl2 A G 9: 101,101,737 K437E possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Mxra8 T C 4: 155,841,008 M58T probably damaging Het
Myo16 A G 8: 10,322,676 D125G probably damaging Het
Myom2 A G 8: 15,102,546 Q631R probably benign Het
Nlrp1b T A 11: 71,181,403 H538L probably benign Het
Nme3 T A 17: 24,896,849 probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nub1 A G 5: 24,708,816 E565G possibly damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr378 C T 11: 73,425,446 C179Y probably damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Olfr859 A G 9: 19,808,378 D20G probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Plb1 A G 5: 32,364,199 T1465A unknown Het
Plxna4 T C 6: 32,157,980 N1763D possibly damaging Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Ralb C T 1: 119,483,535 V25I probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rnf43 A G 11: 87,727,445 E187G probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scap A G 9: 110,377,644 S386G probably damaging Het
Skint10 T C 4: 112,715,870 Y243C probably damaging Het
Stpg2 A G 3: 139,419,786 T447A probably benign Het
Tas1r1 G A 4: 152,038,325 A21V probably damaging Het
Tas2r122 C T 6: 132,711,372 G186E probably benign Het
Tenm4 C A 7: 96,896,209 Y2477* probably null Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tmcc2 A C 1: 132,357,805 S608A probably benign Het
Ttc41 T C 10: 86,760,920 probably null Het
Ttk T A 9: 83,862,535 N593K possibly damaging Het
Tulp1 A G 17: 28,359,198 V289A possibly damaging Het
Uhrf1bp1l T A 10: 89,808,521 M29K probably benign Het
Usp34 A C 11: 23,488,336 Q278P probably damaging Het
Vmn2r78 T A 7: 86,921,529 D418E probably benign Het
Vmn2r90 C T 17: 17,712,074 A81V probably damaging Het
Xpc T A 6: 91,498,135 N636I probably damaging Het
Zfp563 A T 17: 33,089,457 probably benign Het
Other mutations in Parl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Parl APN 16 20298208 missense probably damaging 0.99
IGL01013:Parl APN 16 20282790 missense possibly damaging 0.50
IGL02159:Parl APN 16 20280088 splice site probably benign
IGL02189:Parl APN 16 20297703 missense probably damaging 1.00
R0233:Parl UTSW 16 20287907 missense probably damaging 0.96
R1301:Parl UTSW 16 20286926 missense probably damaging 1.00
R1954:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R1955:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R2353:Parl UTSW 16 20287040 missense probably benign 0.08
R3884:Parl UTSW 16 20283012 missense probably damaging 0.98
R5345:Parl UTSW 16 20298142 missense probably damaging 0.99
R5477:Parl UTSW 16 20280074 missense possibly damaging 0.90
R5687:Parl UTSW 16 20287978 intron probably benign
R6238:Parl UTSW 16 20302213 missense possibly damaging 0.94
R7311:Parl UTSW 16 20287875 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTGTATCCATGGCAATGATGG -3'
(R):5'- ATTATGTGACAACCTGGGTCCC -3'

Sequencing Primer
(F):5'- GCCTAGAAGCCAGGAAGATAAAAC -3'
(R):5'- GGGTCCCTTTCTCTGATACTGTG -3'
Posted On2016-10-24