Incidental Mutation 'R0046:Rgs12'
ID43697
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Nameregulator of G-protein signaling 12
Synonyms1200016K18Rik, 4632412M04Rik
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34949445-35039644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34965320 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 149 (I149N)
Ref Sequence ENSEMBL: ENSMUSP00000084970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684]
Predicted Effect probably damaging
Transcript: ENSMUST00000030984
AA Change: I149N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: I149N

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087684
AA Change: I149N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: I149N

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128161
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dhx9 C T 1: 153,472,707 V291M probably benign Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 34975219 missense probably benign 0.25
IGL02296:Rgs12 APN 5 34966120 missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35020353 missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35030517 missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35025883 missense probably damaging 0.97
IGL02989:Rgs12 APN 5 34965119 missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35030080 missense probably benign 0.01
R0611:Rgs12 UTSW 5 35019460 missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35023122 missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35024366 unclassified probably benign
R1174:Rgs12 UTSW 5 34966465 missense probably benign 0.00
R1538:Rgs12 UTSW 5 35021167 missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35039282 missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 34966403 missense probably benign 0.34
R1791:Rgs12 UTSW 5 34966112 missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 34965674 missense probably damaging 1.00
R1872:Rgs12 UTSW 5 34965821 missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35032269 missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35030528 missense probably benign 0.00
R2107:Rgs12 UTSW 5 34966735 missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35032354 missense probably damaging 1.00
R3826:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35032311 missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35020356 missense probably damaging 1.00
R5132:Rgs12 UTSW 5 34989812 intron probably benign
R5213:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35021104 unclassified probably benign
R5480:Rgs12 UTSW 5 34966111 missense probably benign 0.09
R5510:Rgs12 UTSW 5 34966039 missense probably damaging 1.00
R5708:Rgs12 UTSW 5 34966352 missense probably benign 0.41
R5987:Rgs12 UTSW 5 35020345 missense probably damaging 1.00
R6053:Rgs12 UTSW 5 34965952 missense probably benign 0.01
R6113:Rgs12 UTSW 5 35020323 missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35020332 missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35023092 missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35023171 missense probably null 0.27
R6857:Rgs12 UTSW 5 35030022 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGACCAGATACTTGCCATCAAC -3'
(R):5'- CAAAGTCATCGTGACTGTCCAGACC -3'

Sequencing Primer
(F):5'- CCTCCCATGAAGATGTGGTG -3'
(R):5'- GACTGTCCAGACCCACAGTG -3'
Posted On2013-05-29