Incidental Mutation 'R5568:Nfatc1'
ID437075
Institutional Source Beutler Lab
Gene Symbol Nfatc1
Ensembl Gene ENSMUSG00000033016
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
SynonymsNFATc, NFAT2, 2210017P03Rik, NF-ATc
MMRRC Submission 043125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5568 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80606205-80713071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80649822 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 688 (V688D)
Ref Sequence ENSEMBL: ENSMUSP00000046312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]
Predicted Effect probably benign
Transcript: ENSMUST00000035800
AA Change: V688D

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: V688D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 7.4e-28 PFAM
IPT 582 681 8.99e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078049
SMART Domains Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD 429 589 1.3e-27 PFAM
IPT 596 695 8.99e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167977
SMART Domains Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 4.9e-28 PFAM
IPT 582 681 8.99e-21 SMART
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170905
SMART Domains Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD_DNA_bind 429 589 5.1e-28 PFAM
IPT 596 695 8.99e-21 SMART
low complexity region 846 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,622,794 V207A probably benign Het
Abcc10 C A 17: 46,303,908 probably null Het
Abcc9 A C 6: 142,689,016 V174G possibly damaging Het
Abl1 C T 2: 31,779,074 A155V probably damaging Het
Aco2 T A 15: 81,903,586 D212E probably damaging Het
Adam26b A T 8: 43,520,492 M491K probably benign Het
Anapc5 G A 5: 122,791,925 probably benign Het
Atf7 A G 15: 102,563,322 I46T probably damaging Het
Cacna1b A G 2: 24,607,600 S2100P probably damaging Het
Capn5 T A 7: 98,125,930 D501V probably damaging Het
Cc2d2a A G 5: 43,709,091 M748V probably damaging Het
Cd300c2 T C 11: 115,000,836 T71A probably damaging Het
Chmp2a T C 7: 13,033,831 M56V probably benign Het
Cilp A C 9: 65,280,233 R1203S probably benign Het
Clp1 T A 2: 84,725,978 K53* probably null Het
Crhbp T A 13: 95,442,229 D128V probably damaging Het
Crispld1 T A 1: 17,750,271 I292N probably benign Het
Cyp2c68 A T 19: 39,689,082 I488N probably benign Het
Cyp3a57 A T 5: 145,370,646 M149L probably benign Het
Ddx24 T A 12: 103,424,288 Q59L possibly damaging Het
Ddx27 A G 2: 167,029,519 H512R possibly damaging Het
Ddx58 T A 4: 40,222,140 M380L probably benign Het
Dlgap4 T A 2: 156,762,901 *993K probably null Het
Dmxl2 A T 9: 54,423,359 probably null Het
Dus4l A T 12: 31,646,713 F88L probably damaging Het
Ep400 A T 5: 110,756,205 V176E probably damaging Het
Fam71e1 T G 7: 44,501,004 S207A probably damaging Het
Fat3 T A 9: 16,376,923 K435* probably null Het
Fsip2 T C 2: 82,986,564 C4214R probably benign Het
Gfral T C 9: 76,164,805 *394W probably null Het
Glis1 T C 4: 107,619,635 S518P probably damaging Het
H2-T10 A G 17: 36,119,187 probably null Het
Hsbp1l1 T C 18: 80,235,464 T35A possibly damaging Het
Ighv5-12 A G 12: 113,702,217 F87S probably damaging Het
Ints13 A C 6: 146,576,357 D31E probably damaging Het
Kbtbd12 C T 6: 88,618,627 D74N probably damaging Het
Klrb1c A G 6: 128,788,914 probably benign Het
Kmt5b A T 19: 3,786,538 H25L probably benign Het
Krt28 A T 11: 99,371,384 M260K probably damaging Het
Krt79 A G 15: 101,929,785 S512P probably damaging Het
Lama1 A T 17: 67,768,298 probably null Het
Maneal T C 4: 124,857,144 E273G possibly damaging Het
Map4k3 T A 17: 80,663,998 Y80F possibly damaging Het
Mbd6 A G 10: 127,283,428 V946A possibly damaging Het
Mfsd14b A T 13: 65,072,122 probably null Het
Mrpl46 C G 7: 78,780,494 W176S probably damaging Het
Muc19 A G 15: 91,884,274 noncoding transcript Het
Mup3 T G 4: 62,084,572 E184A possibly damaging Het
Myo9a A G 9: 59,874,628 H1699R probably benign Het
Ndrg2 T A 14: 51,906,963 T269S probably damaging Het
Ninj2 T C 6: 120,198,709 I101T probably benign Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Npsr1 T A 9: 24,313,214 L296I probably damaging Het
Olfr582 G T 7: 103,042,310 R272L possibly damaging Het
Olfr975 A G 9: 39,950,687 L28P probably benign Het
Pacsin1 T A 17: 27,708,048 D242E probably damaging Het
Pcdh1 T C 18: 38,197,367 Y861C probably damaging Het
Pcdha12 T C 18: 37,020,390 L54P probably damaging Het
Pcdhb18 T A 18: 37,491,800 S728T probably benign Het
Phyhd1 T A 2: 30,277,010 H108Q probably damaging Het
Plcb1 A T 2: 135,370,593 I1035F probably damaging Het
Plcl1 T C 1: 55,696,150 S217P possibly damaging Het
Plppr2 G A 9: 21,941,129 R103H probably damaging Het
Plxnb2 G A 15: 89,157,435 T1722I probably damaging Het
Pole3 T C 4: 62,524,431 N53S probably damaging Het
Ptk6 A T 2: 181,199,695 N140K possibly damaging Het
Rab12 C T 17: 66,497,423 R180H probably damaging Het
Rab36 G T 10: 75,052,479 V252L probably benign Het
Ranbp3 T C 17: 56,701,543 probably null Het
Rapgef2 A G 3: 79,104,001 L259P probably damaging Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scd2 T C 19: 44,299,703 F178S probably damaging Het
Shmt2 A G 10: 127,520,381 S87P probably damaging Het
Slf1 T A 13: 77,046,704 D834V probably damaging Het
Sorcs2 A C 5: 36,046,530 Y540* probably null Het
Srpk2 T A 5: 23,525,699 Q274L possibly damaging Het
Stradb T A 1: 58,992,742 M271K possibly damaging Het
Tfec T A 6: 16,867,593 Q16L possibly damaging Het
Tfg T C 16: 56,701,087 T63A probably benign Het
Ticrr G A 7: 79,689,967 probably null Het
Ticrr T A 7: 79,695,296 C1636* probably null Het
Tln2 A G 9: 67,311,865 I266T probably damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tnnt3 A G 7: 142,512,040 E138G probably damaging Het
Tpm2 C A 4: 43,522,692 E75* probably null Het
Ttn T G 2: 76,750,578 T23324P probably damaging Het
Ubr4 T G 4: 139,392,038 L176R probably damaging Het
Uhrf2 G T 19: 30,039,088 D46Y probably damaging Het
Ulbp1 A C 10: 7,473,281 S21A unknown Het
Usp17lb C T 7: 104,841,208 G170R probably damaging Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vcan T A 13: 89,688,671 E2918V probably damaging Het
Vmn1r174 T A 7: 23,754,494 I195K probably damaging Het
Vmn1r76 C T 7: 11,931,135 V16I probably benign Het
Xdh T C 17: 73,943,885 D24G possibly damaging Het
Xylb T A 9: 119,361,132 H68Q probably benign Het
Other mutations in Nfatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Nfatc1 APN 18 80667026 missense probably damaging 1.00
IGL00742:Nfatc1 APN 18 80698014 missense probably benign 0.20
IGL01510:Nfatc1 APN 18 80698188 missense probably damaging 1.00
IGL01790:Nfatc1 APN 18 80667042 missense probably damaging 1.00
IGL02548:Nfatc1 APN 18 80697898 missense probably damaging 1.00
goldfeld UTSW 18 80697832 missense probably damaging 0.99
R0019:Nfatc1 UTSW 18 80635504 missense probably benign
R0411:Nfatc1 UTSW 18 80698042 missense possibly damaging 0.88
R0738:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R0940:Nfatc1 UTSW 18 80635895 missense probably benign 0.03
R1458:Nfatc1 UTSW 18 80665267 splice site probably benign
R1622:Nfatc1 UTSW 18 80666967 missense probably damaging 1.00
R1845:Nfatc1 UTSW 18 80635531 missense possibly damaging 0.67
R2110:Nfatc1 UTSW 18 80635664 nonsense probably null
R2112:Nfatc1 UTSW 18 80635664 nonsense probably null
R2157:Nfatc1 UTSW 18 80635845 missense possibly damaging 0.88
R3857:Nfatc1 UTSW 18 80665275 splice site probably benign
R3859:Nfatc1 UTSW 18 80665275 splice site probably benign
R4108:Nfatc1 UTSW 18 80698368 missense possibly damaging 0.68
R4510:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4511:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4618:Nfatc1 UTSW 18 80697832 missense probably damaging 0.99
R4850:Nfatc1 UTSW 18 80697865 missense probably benign 0.30
R5329:Nfatc1 UTSW 18 80708117 start codon destroyed probably null
R5395:Nfatc1 UTSW 18 80636020 missense possibly damaging 0.80
R5468:Nfatc1 UTSW 18 80649855 missense probably benign 0.00
R5522:Nfatc1 UTSW 18 80653529 missense probably benign 0.36
R6111:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R6190:Nfatc1 UTSW 18 80712670 missense probably benign 0.21
R6397:Nfatc1 UTSW 18 80635941 missense probably damaging 1.00
R6943:Nfatc1 UTSW 18 80635555 missense probably damaging 1.00
R6970:Nfatc1 UTSW 18 80667013 missense probably benign 0.34
X0062:Nfatc1 UTSW 18 80697618 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAGTGATGACCCCAGCATGC -3'
(R):5'- AAGGTCCTGACTGTTCCCTC -3'

Sequencing Primer
(F):5'- GCATGCACCAGTCACAGG -3'
(R):5'- CTTTGCTGTTTTACCACCAGAATTC -3'
Posted On2016-10-24