Incidental Mutation 'R5575:Col5a2'
ID437144
Institutional Source Beutler Lab
Gene Symbol Col5a2
Ensembl Gene ENSMUSG00000026042
Gene Namecollagen, type V, alpha 2
Synonyms1110014L14Rik
MMRRC Submission 043130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5575 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45374321-45503282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45378482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1311 (I1311N)
Ref Sequence ENSEMBL: ENSMUSP00000083620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086430]
Predicted Effect probably damaging
Transcript: ENSMUST00000086430
AA Change: I1311N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: I1311N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 40 95 9.94e-23 SMART
Pfam:Collagen 123 186 1.5e-10 PFAM
Pfam:Collagen 207 272 2.9e-9 PFAM
low complexity region 319 347 N/A INTRINSIC
internal_repeat_1 349 421 3.18e-18 PROSPERO
internal_repeat_2 385 422 1.34e-12 PROSPERO
internal_repeat_5 388 423 1.55e-7 PROSPERO
low complexity region 424 460 N/A INTRINSIC
low complexity region 471 508 N/A INTRINSIC
internal_repeat_6 509 535 5.68e-7 PROSPERO
internal_repeat_2 511 548 1.34e-12 PROSPERO
internal_repeat_3 520 549 1.16e-11 PROSPERO
internal_repeat_1 520 571 3.18e-18 PROSPERO
internal_repeat_4 546 574 4.91e-9 PROSPERO
low complexity region 595 611 N/A INTRINSIC
internal_repeat_7 616 741 1.35e-6 PROSPERO
low complexity region 742 757 N/A INTRINSIC
Pfam:Collagen 790 870 4.8e-8 PFAM
low complexity region 877 898 N/A INTRINSIC
Pfam:Collagen 907 979 4.2e-8 PFAM
internal_repeat_4 993 1021 4.91e-9 PROSPERO
internal_repeat_3 994 1023 1.16e-11 PROSPERO
low complexity region 1024 1054 N/A INTRINSIC
internal_repeat_6 1055 1078 5.68e-7 PROSPERO
low complexity region 1081 1096 N/A INTRINSIC
Pfam:Collagen 1111 1171 9.7e-12 PFAM
Pfam:Collagen 1168 1230 1.4e-9 PFAM
COLFI 1263 1497 1.83e-164 SMART
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Aplf A C 6: 87,646,147 C338G probably benign Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col9a3 A T 2: 180,598,846 probably benign Het
Dsc2 A T 18: 20,035,390 C671S probably damaging Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hk3 A T 13: 55,014,770 D88E probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Thada A C 17: 84,416,399 probably null Het
Themis3 A G 17: 66,555,326 S546P possibly damaging Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in Col5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Col5a2 APN 1 45392877 splice site probably benign
IGL00978:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01366:Col5a2 APN 1 45391888 missense possibly damaging 0.46
IGL01487:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01820:Col5a2 APN 1 45442825 missense unknown
IGL01980:Col5a2 APN 1 45382233 splice site probably benign
IGL02063:Col5a2 APN 1 45403419 critical splice donor site probably null
IGL02134:Col5a2 APN 1 45391070 splice site probably null
IGL02233:Col5a2 APN 1 45383587 splice site probably null
IGL02489:Col5a2 APN 1 45392811 splice site probably null
IGL02928:Col5a2 APN 1 45385020 missense probably benign 0.41
IGL02931:Col5a2 APN 1 45385065 missense probably damaging 1.00
IGL03328:Col5a2 APN 1 45376146 missense possibly damaging 0.94
R0022:Col5a2 UTSW 1 45383683 nonsense probably null
R0123:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0180:Col5a2 UTSW 1 45411460 missense probably damaging 1.00
R0225:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0455:Col5a2 UTSW 1 45382102 splice site probably benign
R0485:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R0702:Col5a2 UTSW 1 45380131 missense possibly damaging 0.54
R0745:Col5a2 UTSW 1 45407227 splice site probably null
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1394:Col5a2 UTSW 1 45403419 critical splice donor site probably null
R1494:Col5a2 UTSW 1 45502914 start codon destroyed unknown
R1499:Col5a2 UTSW 1 45411466 missense probably benign 0.00
R1733:Col5a2 UTSW 1 45407032 missense possibly damaging 0.81
R1789:Col5a2 UTSW 1 45378305 critical splice donor site probably null
R1789:Col5a2 UTSW 1 45394776 missense probably damaging 0.98
R2114:Col5a2 UTSW 1 45376804 missense probably damaging 0.98
R2915:Col5a2 UTSW 1 45413496 missense probably damaging 1.00
R3861:Col5a2 UTSW 1 45380237 missense probably damaging 0.98
R4015:Col5a2 UTSW 1 45403471 missense probably benign 0.14
R4944:Col5a2 UTSW 1 45376695 missense possibly damaging 0.75
R4982:Col5a2 UTSW 1 45389458 missense possibly damaging 0.88
R5001:Col5a2 UTSW 1 45502898 missense unknown
R5159:Col5a2 UTSW 1 45386831 critical splice donor site probably null
R5197:Col5a2 UTSW 1 45393081 missense probably benign 0.01
R5407:Col5a2 UTSW 1 45406280 missense possibly damaging 0.54
R5502:Col5a2 UTSW 1 45380126 missense probably damaging 1.00
R5622:Col5a2 UTSW 1 45427059 missense probably benign
R5643:Col5a2 UTSW 1 45390042 missense probably damaging 1.00
R5801:Col5a2 UTSW 1 45389481 critical splice acceptor site probably null
R6075:Col5a2 UTSW 1 45502848 missense unknown
R6211:Col5a2 UTSW 1 45376666 missense probably damaging 0.99
R6407:Col5a2 UTSW 1 45376778 missense probably damaging 0.99
R6494:Col5a2 UTSW 1 45378327 missense probably damaging 0.99
R6582:Col5a2 UTSW 1 45390115 missense possibly damaging 0.91
R6687:Col5a2 UTSW 1 45383604 missense probably damaging 1.00
R7007:Col5a2 UTSW 1 45378449 missense possibly damaging 0.53
R7062:Col5a2 UTSW 1 45417625 missense probably benign 0.00
R7098:Col5a2 UTSW 1 45380067 missense possibly damaging 0.48
R7243:Col5a2 UTSW 1 45376160 missense probably benign 0.39
R7326:Col5a2 UTSW 1 45442867 missense unknown
R7332:Col5a2 UTSW 1 45380165 missense probably damaging 1.00
X0013:Col5a2 UTSW 1 45403258 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCCTCTATTCATGTCAAGACCG -3'
(R):5'- AAGAAGACCCCTAGTGCTTAATAG -3'

Sequencing Primer
(F):5'- GTACCACACAGGCTTATTGTCAGG -3'
(R):5'- AATTGGCTCACTGTAGGGATCTCC -3'
Posted On2016-10-26