Incidental Mutation 'R5575:Aplf'
ID437161
Institutional Source Beutler Lab
Gene Symbol Aplf
Ensembl Gene ENSMUSG00000030051
Gene Nameaprataxin and PNKP like factor
Synonyms2010301N04Rik
MMRRC Submission 043130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5575 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87628424-87672193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87646147 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 338 (C338G)
Ref Sequence ENSEMBL: ENSMUSP00000032130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032130] [ENSMUST00000065997] [ENSMUST00000203209]
Predicted Effect probably benign
Transcript: ENSMUST00000032130
AA Change: C338G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032130
Gene: ENSMUSG00000030051
AA Change: C338G

DomainStartEndE-ValueType
SCOP:d1lgpa_ 6 105 2e-11 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
Pfam:zf-CCHH 372 396 1.7e-16 PFAM
Pfam:zf-CCHH 414 437 6.8e-15 PFAM
low complexity region 456 471 N/A INTRINSIC
low complexity region 477 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065997
AA Change: C317G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000066232
Gene: ENSMUSG00000030051
AA Change: C317G

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 84 7e-6 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
Pfam:zf-CCHH 351 376 1.7e-15 PFAM
Pfam:zf-CCHH 393 417 1.9e-15 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 456 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203776
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased repair of gamma irradiation-induced DNA damage and increased microhomology at class switch recombination junctions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col9a3 A T 2: 180,598,846 probably benign Het
Dsc2 A T 18: 20,035,390 C671S probably damaging Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hk3 A T 13: 55,014,770 D88E probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Thada A C 17: 84,416,399 probably null Het
Themis3 A G 17: 66,555,326 S546P possibly damaging Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in Aplf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Aplf APN 6 87668408 splice site probably benign
IGL01304:Aplf APN 6 87641900 missense possibly damaging 0.71
IGL02267:Aplf APN 6 87658964 missense probably damaging 1.00
R0294:Aplf UTSW 6 87646245 missense probably benign 0.02
R0352:Aplf UTSW 6 87653884 missense probably benign 0.01
R0445:Aplf UTSW 6 87663752 missense probably damaging 1.00
R0959:Aplf UTSW 6 87646083 missense probably benign 0.24
R1127:Aplf UTSW 6 87646291 missense probably benign 0.00
R1583:Aplf UTSW 6 87646033 missense probably damaging 1.00
R2878:Aplf UTSW 6 87668427 nonsense probably null
R3617:Aplf UTSW 6 87671883 missense possibly damaging 0.85
R4708:Aplf UTSW 6 87663757 missense probably damaging 1.00
R4823:Aplf UTSW 6 87646255 missense probably damaging 1.00
R4919:Aplf UTSW 6 87630064 missense possibly damaging 0.94
R4941:Aplf UTSW 6 87668423 missense probably damaging 1.00
R4941:Aplf UTSW 6 87646349 missense probably benign 0.00
R5208:Aplf UTSW 6 87642026 splice site probably null
R6271:Aplf UTSW 6 87646248 missense possibly damaging 0.88
R6381:Aplf UTSW 6 87658977 missense probably damaging 0.96
R6772:Aplf UTSW 6 87663799 missense possibly damaging 0.76
R6906:Aplf UTSW 6 87630086 missense possibly damaging 0.65
R6975:Aplf UTSW 6 87646086 missense probably damaging 0.98
R7015:Aplf UTSW 6 87641902 missense probably damaging 0.99
R7038:Aplf UTSW 6 87653823 nonsense probably null
R7296:Aplf UTSW 6 87646215 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGAAGGCAATGGTTCATTAAG -3'
(R):5'- CTTCAAACATAGTAAAGGACCCAGATG -3'

Sequencing Primer
(F):5'- TCATTAAGCTTTTAATACACACAGGG -3'
(R):5'- CTTGGTGAGGTCTCTAAAC -3'
Posted On2016-10-26