Mutagenetix > Incidental Mutation

Incidental Mutation 'R5575:Trpm1'

437165

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, melastatin, 4732499L03Rik, LTRPC1

MMRRC Submission

043130-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5575 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63803583-63919523 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63870018 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 441 (L441P)

Ref Sequence

ENSEMBL: ENSMUSP00000134947 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000205731] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: L557P

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L557P

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107516
AA Change: C557R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140277
AA Change: L148P

Predicted Effect

probably benign
Transcript: ENSMUST00000176623
AA Change: L65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134805
Gene: ENSMUSG00000030523
AA Change: L65P

Domain	Start	End	E-Value	Type
Blast:ANK	13	41	1e-6	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177102
AA Change: L441P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: L441P

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

probably benign
Transcript: ENSMUST00000205994
AA Change: L65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: L441P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: L557P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Meta Mutation Damage Score

0.2254

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	C	T	14: 54,916,195 (GRCm39)		probably null	Het
Adrm1	T	G	2: 179,817,509 (GRCm39)	D325E	probably benign	Het
Anapc4	T	A	5: 53,013,213 (GRCm39)	V433E	probably damaging	Het
Aplf	A	C	6: 87,623,129 (GRCm39)	C338G	probably benign	Het
Atad5	A	G	11: 79,991,149 (GRCm39)	T681A	probably benign	Het
B9d2	A	G	7: 25,382,757 (GRCm39)	T44A	probably damaging	Het
Catsperg2	T	C	7: 29,405,015 (GRCm39)	K81R	possibly damaging	Het
Cep170b	T	A	12: 112,702,066 (GRCm39)	H286Q	probably damaging	Het
Cfap61	G	A	2: 145,859,313 (GRCm39)	V434I	probably benign	Het
Col5a2	A	T	1: 45,417,642 (GRCm39)	I1311N	probably damaging	Het
Col9a3	A	T	2: 180,240,639 (GRCm39)		probably benign	Het
Dsc2	A	T	18: 20,168,447 (GRCm39)	C671S	probably damaging	Het
Eif5	T	C	12: 111,508,740 (GRCm39)	V245A	probably damaging	Het
Epha5	G	A	5: 84,564,361 (GRCm39)	R2W	probably damaging	Het
Gabrb2	G	A	11: 42,420,365 (GRCm39)		probably benign	Het
Gm3453	A	G	14: 5,978,205 (GRCm38)	V66A	possibly damaging	Het
Gna15	T	C	10: 81,359,707 (GRCm39)	I28V	probably damaging	Het
Hk3	A	T	13: 55,162,583 (GRCm39)	D88E	probably damaging	Het
Hmbox1	T	C	14: 65,060,613 (GRCm39)	T375A	probably benign	Het
Ibsp	A	T	5: 104,457,925 (GRCm39)	E154V	possibly damaging	Het
Il7r	A	G	15: 9,508,273 (GRCm39)	S350P	probably benign	Het
Isx	T	C	8: 75,619,429 (GRCm39)	L207P	probably benign	Het
Krt35	T	C	11: 99,985,450 (GRCm39)	E197G	probably damaging	Het
Krt78	G	A	15: 101,855,787 (GRCm39)	Q675*	probably null	Het
Marchf1	T	A	8: 66,920,962 (GRCm39)	V217E	probably damaging	Het
Mertk	T	C	2: 128,578,485 (GRCm39)	I157T	probably damaging	Het
Mmab	A	T	5: 114,574,832 (GRCm39)	L147Q	probably damaging	Het
Ndst4	T	A	3: 125,231,479 (GRCm39)	V16D	probably benign	Het
Niban1	A	T	1: 151,593,991 (GRCm39)	H892L	probably benign	Het
Ogdhl	T	C	14: 32,047,804 (GRCm39)	L18P	possibly damaging	Het
Pikfyve	A	C	1: 65,312,889 (GRCm39)	H2089P	probably damaging	Het
Plxna1	A	T	6: 89,301,523 (GRCm39)	L1501Q	possibly damaging	Het
Ppp2r5c	T	C	12: 110,519,266 (GRCm39)	F246S	probably damaging	Het
Ptbp2	A	T	3: 119,514,432 (GRCm39)		probably null	Het
Ptbp2	G	A	3: 119,514,438 (GRCm39)	P463L	possibly damaging	Het
Rad51	A	G	2: 118,964,914 (GRCm39)	D274G	probably benign	Het
Ranbp2	T	C	10: 58,328,405 (GRCm39)	V2807A	probably damaging	Het
Rapgef4	G	A	2: 71,864,464 (GRCm39)		probably null	Het
Rp1l1	C	T	14: 64,268,433 (GRCm39)	H1340Y	probably benign	Het
Ryr1	T	A	7: 28,778,118 (GRCm39)	H2133L	possibly damaging	Het
Scgb1c1	G	A	7: 140,426,024 (GRCm39)	G40E	probably damaging	Het
Shank2	T	C	7: 143,963,871 (GRCm39)	I703T	probably damaging	Het
Spag17	G	A	3: 99,961,138 (GRCm39)	A975T	possibly damaging	Het
Supt6	T	C	11: 78,119,787 (GRCm39)	D400G	probably damaging	Het
Synrg	T	C	11: 83,900,378 (GRCm39)		probably null	Het
Thada	A	C	17: 84,723,827 (GRCm39)		probably null	Het
Themis3	A	G	17: 66,862,321 (GRCm39)	S546P	possibly damaging	Het
Tinf2	T	C	14: 55,917,631 (GRCm39)	D286G	probably benign	Het
Tmem67	A	T	4: 12,047,886 (GRCm39)	V815D	possibly damaging	Het
Vapa	A	G	17: 65,920,247 (GRCm39)	V16A	probably benign	Het
Vmn2r38	A	T	7: 9,078,635 (GRCm39)	Y582*	probably null	Het
Vps13b	A	T	15: 35,930,065 (GRCm39)	K3934I	probably damaging	Het
Wrn	G	A	8: 33,826,158 (GRCm39)	T168I	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	63,893,198 (GRCm39)	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	63,897,215 (GRCm39)	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	63,885,572 (GRCm39)	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	63,893,312 (GRCm39)	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	63,860,578 (GRCm39)	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	63,884,767 (GRCm39)	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	63,854,276 (GRCm39)	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	63,893,329 (GRCm39)	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	63,918,637 (GRCm39)	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	63,876,645 (GRCm39)	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	63,884,742 (GRCm39)	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	63,858,723 (GRCm39)	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	63,860,613 (GRCm39)	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	63,867,362 (GRCm39)	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	63,884,800 (GRCm39)	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	63,895,690 (GRCm39)	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	63,868,869 (GRCm39)	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	63,890,175 (GRCm39)	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	63,918,862 (GRCm39)	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	63,848,972 (GRCm39)	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	63,868,881 (GRCm39)	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	63,868,908 (GRCm39)	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	63,918,309 (GRCm39)	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	63,848,998 (GRCm39)	intron	probably benign
R0012:Trpm1	UTSW	7	63,918,339 (GRCm39)	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	63,897,970 (GRCm39)	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	63,893,334 (GRCm39)	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	63,894,590 (GRCm39)	unclassified	probably benign
R0463:Trpm1	UTSW	7	63,870,002 (GRCm39)	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	63,852,801 (GRCm39)	splice site	probably null
R1397:Trpm1	UTSW	7	63,867,406 (GRCm39)	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	63,873,565 (GRCm39)	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	63,890,283 (GRCm39)	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	63,885,569 (GRCm39)	nonsense	probably null
R1827:Trpm1	UTSW	7	63,884,755 (GRCm39)	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	63,876,530 (GRCm39)	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	63,880,016 (GRCm39)	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	63,917,764 (GRCm39)	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	63,858,182 (GRCm39)	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	63,858,780 (GRCm39)	intron	probably null
R2054:Trpm1	UTSW	7	63,890,303 (GRCm39)	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	63,884,736 (GRCm39)	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	63,859,724 (GRCm39)	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	63,918,849 (GRCm39)	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	63,884,760 (GRCm39)	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	63,849,061 (GRCm39)	nonsense	probably null
R3615:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	63,867,475 (GRCm39)	intron	probably benign
R3822:Trpm1	UTSW	7	63,867,451 (GRCm39)	intron	probably benign
R4441:Trpm1	UTSW	7	63,851,666 (GRCm39)	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	63,858,660 (GRCm39)	nonsense	probably null
R4666:Trpm1	UTSW	7	63,852,782 (GRCm39)	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	63,893,248 (GRCm39)	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	63,884,800 (GRCm39)	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	63,858,054 (GRCm39)	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	63,894,580 (GRCm39)	unclassified	probably benign
R5030:Trpm1	UTSW	7	63,885,579 (GRCm39)	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	63,887,441 (GRCm39)	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	63,918,702 (GRCm39)	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	63,858,694 (GRCm39)	missense	probably benign	0.00
R5613:Trpm1	UTSW	7	63,858,159 (GRCm39)	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	63,918,710 (GRCm39)	nonsense	probably null
R5947:Trpm1	UTSW	7	63,873,547 (GRCm39)	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	63,876,553 (GRCm39)	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	63,918,450 (GRCm39)	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	63,917,724 (GRCm39)	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	63,918,226 (GRCm39)	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	63,848,942 (GRCm39)	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	63,918,252 (GRCm39)	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	63,803,781 (GRCm39)	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	63,890,343 (GRCm39)	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	63,893,181 (GRCm39)	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	63,876,462 (GRCm39)	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	63,885,593 (GRCm39)	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	63,918,445 (GRCm39)	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	63,854,333 (GRCm39)	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	63,868,854 (GRCm39)	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	63,859,729 (GRCm39)	nonsense	probably null
R7367:Trpm1	UTSW	7	63,918,549 (GRCm39)	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	63,858,723 (GRCm39)	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	63,890,330 (GRCm39)	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	63,858,657 (GRCm39)	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	63,854,303 (GRCm39)	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	63,897,939 (GRCm39)	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	63,851,689 (GRCm39)	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	63,858,718 (GRCm39)	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	63,849,017 (GRCm39)	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	63,851,699 (GRCm39)	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	63,918,541 (GRCm39)	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	63,897,155 (GRCm39)	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	63,874,356 (GRCm39)	splice site	probably null
R8813:Trpm1	UTSW	7	63,851,756 (GRCm39)	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	63,918,628 (GRCm39)	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	63,858,089 (GRCm39)	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	63,848,943 (GRCm39)	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	63,890,319 (GRCm39)	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	63,884,713 (GRCm39)	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	63,873,623 (GRCm39)	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	63,918,480 (GRCm39)	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	63,873,446 (GRCm39)	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	63,803,616 (GRCm39)	unclassified	probably benign
R9616:Trpm1	UTSW	7	63,858,132 (GRCm39)	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	63,898,041 (GRCm39)	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	63,918,658 (GRCm39)	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	63,854,342 (GRCm39)	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	63,852,879 (GRCm39)	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	63,867,439 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACACGTTTGAGTGGGGTAAC -3'
(R):5'- GCACTTTACAGCCATCTATGTC -3'

Sequencing Primer
(F):5'- CCACAGCCAGTTGTCTTATAAAGG -3'
(R):5'- ACAGCCATCTATGTCCCTGG -3'

Posted On

2016-10-26