Incidental Mutation 'R5575:Tinf2'
ID 437187
Institutional Source Beutler Lab
Gene Symbol Tinf2
Ensembl Gene ENSMUSG00000007589
Gene Name Terf1 (TRF1)-interacting nuclear factor 2
Synonyms D14Wsu146e, TIN2
MMRRC Submission 043130-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5575 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55912146-55919277 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55917631 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 286 (D286G)
Ref Sequence ENSEMBL: ENSMUSP00000154628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002397] [ENSMUST00000007733] [ENSMUST00000226314] [ENSMUST00000227842] [ENSMUST00000227178] [ENSMUST00000227873] [ENSMUST00000227914]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002397
SMART Domains Protein: ENSMUSP00000002397
Gene: ENSMUSG00000002326

DomainStartEndE-ValueType
IMPDH 8 347 7.5e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007733
AA Change: D286G

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000007733
Gene: ENSMUSG00000007589
AA Change: D286G

DomainStartEndE-ValueType
Pfam:TINF2_N 20 159 1.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157777
Predicted Effect probably benign
Transcript: ENSMUST00000226314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226641
Predicted Effect probably benign
Transcript: ENSMUST00000226819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect probably benign
Transcript: ENSMUST00000227842
AA Change: D286G

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227996
Predicted Effect probably benign
Transcript: ENSMUST00000227178
Predicted Effect probably benign
Transcript: ENSMUST00000227873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227696
Predicted Effect probably benign
Transcript: ENSMUST00000227914
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins of the shelterin, or telosome, complex which protects telomeres by allowing the cell to distinguish between telomeres and regions of DNA damage. The protein encoded by this gene is a critical part of shelterin; it interacts with the three DNA-binding proteins of the shelterin complex, and it is important for assembly of the complex. Mutations in this gene cause dyskeratosis congenita (DKC), an inherited bone marrow failure syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality prior to E7.5 through a mechanism that is independent of telomerase function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,916,195 (GRCm39) probably null Het
Adrm1 T G 2: 179,817,509 (GRCm39) D325E probably benign Het
Anapc4 T A 5: 53,013,213 (GRCm39) V433E probably damaging Het
Aplf A C 6: 87,623,129 (GRCm39) C338G probably benign Het
Atad5 A G 11: 79,991,149 (GRCm39) T681A probably benign Het
B9d2 A G 7: 25,382,757 (GRCm39) T44A probably damaging Het
Catsperg2 T C 7: 29,405,015 (GRCm39) K81R possibly damaging Het
Cep170b T A 12: 112,702,066 (GRCm39) H286Q probably damaging Het
Cfap61 G A 2: 145,859,313 (GRCm39) V434I probably benign Het
Col5a2 A T 1: 45,417,642 (GRCm39) I1311N probably damaging Het
Col9a3 A T 2: 180,240,639 (GRCm39) probably benign Het
Dsc2 A T 18: 20,168,447 (GRCm39) C671S probably damaging Het
Eif5 T C 12: 111,508,740 (GRCm39) V245A probably damaging Het
Epha5 G A 5: 84,564,361 (GRCm39) R2W probably damaging Het
Gabrb2 G A 11: 42,420,365 (GRCm39) probably benign Het
Gm3453 A G 14: 5,978,205 (GRCm38) V66A possibly damaging Het
Gna15 T C 10: 81,359,707 (GRCm39) I28V probably damaging Het
Hk3 A T 13: 55,162,583 (GRCm39) D88E probably damaging Het
Hmbox1 T C 14: 65,060,613 (GRCm39) T375A probably benign Het
Ibsp A T 5: 104,457,925 (GRCm39) E154V possibly damaging Het
Il7r A G 15: 9,508,273 (GRCm39) S350P probably benign Het
Isx T C 8: 75,619,429 (GRCm39) L207P probably benign Het
Krt35 T C 11: 99,985,450 (GRCm39) E197G probably damaging Het
Krt78 G A 15: 101,855,787 (GRCm39) Q675* probably null Het
Marchf1 T A 8: 66,920,962 (GRCm39) V217E probably damaging Het
Mertk T C 2: 128,578,485 (GRCm39) I157T probably damaging Het
Mmab A T 5: 114,574,832 (GRCm39) L147Q probably damaging Het
Ndst4 T A 3: 125,231,479 (GRCm39) V16D probably benign Het
Niban1 A T 1: 151,593,991 (GRCm39) H892L probably benign Het
Ogdhl T C 14: 32,047,804 (GRCm39) L18P possibly damaging Het
Pikfyve A C 1: 65,312,889 (GRCm39) H2089P probably damaging Het
Plxna1 A T 6: 89,301,523 (GRCm39) L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,519,266 (GRCm39) F246S probably damaging Het
Ptbp2 A T 3: 119,514,432 (GRCm39) probably null Het
Ptbp2 G A 3: 119,514,438 (GRCm39) P463L possibly damaging Het
Rad51 A G 2: 118,964,914 (GRCm39) D274G probably benign Het
Ranbp2 T C 10: 58,328,405 (GRCm39) V2807A probably damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rp1l1 C T 14: 64,268,433 (GRCm39) H1340Y probably benign Het
Ryr1 T A 7: 28,778,118 (GRCm39) H2133L possibly damaging Het
Scgb1c1 G A 7: 140,426,024 (GRCm39) G40E probably damaging Het
Shank2 T C 7: 143,963,871 (GRCm39) I703T probably damaging Het
Spag17 G A 3: 99,961,138 (GRCm39) A975T possibly damaging Het
Supt6 T C 11: 78,119,787 (GRCm39) D400G probably damaging Het
Synrg T C 11: 83,900,378 (GRCm39) probably null Het
Thada A C 17: 84,723,827 (GRCm39) probably null Het
Themis3 A G 17: 66,862,321 (GRCm39) S546P possibly damaging Het
Tmem67 A T 4: 12,047,886 (GRCm39) V815D possibly damaging Het
Trpm1 T C 7: 63,870,018 (GRCm39) L441P possibly damaging Het
Vapa A G 17: 65,920,247 (GRCm39) V16A probably benign Het
Vmn2r38 A T 7: 9,078,635 (GRCm39) Y582* probably null Het
Vps13b A T 15: 35,930,065 (GRCm39) K3934I probably damaging Het
Wrn G A 8: 33,826,158 (GRCm39) T168I probably benign Het
Other mutations in Tinf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Tinf2 APN 14 55,917,921 (GRCm39) splice site probably null
IGL01879:Tinf2 APN 14 55,918,363 (GRCm39) unclassified probably benign
IGL03123:Tinf2 APN 14 55,918,346 (GRCm39) missense probably damaging 0.99
R0815:Tinf2 UTSW 14 55,917,566 (GRCm39) missense probably benign 0.01
R0863:Tinf2 UTSW 14 55,917,566 (GRCm39) missense probably benign 0.01
R2862:Tinf2 UTSW 14 55,918,088 (GRCm39) missense probably damaging 1.00
R6833:Tinf2 UTSW 14 55,919,037 (GRCm39) start codon destroyed probably null 1.00
R7389:Tinf2 UTSW 14 55,918,167 (GRCm39) splice site probably null
R8246:Tinf2 UTSW 14 55,917,042 (GRCm39) missense probably damaging 0.97
R8368:Tinf2 UTSW 14 55,917,030 (GRCm39) missense probably damaging 1.00
R9003:Tinf2 UTSW 14 55,917,859 (GRCm39) missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGAGACCCTTACTCCTGCTCTG -3'
(R):5'- GTCCTCATCAGCAAACCAGG -3'

Sequencing Primer
(F):5'- TCTGCAGCCGGTGAGTCAG -3'
(R):5'- GTCCTCTGCCTAAAGCTAAGC -3'
Posted On 2016-10-26