Incidental Mutation 'R5575:Themis3'
ID437194
Institutional Source Beutler Lab
Gene Symbol Themis3
Ensembl Gene ENSMUSG00000024105
Gene Namethymocyte selection associated family member 3
Synonyms
MMRRC Submission 043130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5575 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location66555252-66594621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66555326 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 546 (S546P)
Ref Sequence ENSEMBL: ENSMUSP00000024914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024914
AA Change: S546P

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024914
Gene: ENSMUSG00000024105
AA Change: S546P

DomainStartEndE-ValueType
Pfam:CABIT 17 262 2e-48 PFAM
Pfam:CABIT 272 533 3.5e-49 PFAM
low complexity region 556 566 N/A INTRINSIC
Meta Mutation Damage Score 0.0524 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Aplf A C 6: 87,646,147 C338G probably benign Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col9a3 A T 2: 180,598,846 probably benign Het
Dsc2 A T 18: 20,035,390 C671S probably damaging Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hk3 A T 13: 55,014,770 D88E probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Thada A C 17: 84,416,399 probably null Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in Themis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Themis3 APN 17 66556097 missense probably benign 0.02
IGL01893:Themis3 APN 17 66559627 missense possibly damaging 0.52
IGL02065:Themis3 APN 17 66555905 missense probably benign 0.02
R0345:Themis3 UTSW 17 66559545 critical splice donor site probably null
R0538:Themis3 UTSW 17 66593270 missense possibly damaging 0.95
R0583:Themis3 UTSW 17 66559753 missense probably benign 0.01
R1494:Themis3 UTSW 17 66559954 missense probably benign 0.18
R1713:Themis3 UTSW 17 66555853 missense probably benign 0.00
R2271:Themis3 UTSW 17 66555704 missense possibly damaging 0.57
R4214:Themis3 UTSW 17 66560017 missense probably benign 0.09
R5815:Themis3 UTSW 17 66555704 missense possibly damaging 0.57
R6018:Themis3 UTSW 17 66593209 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCTGCGATTTCCTCTGG -3'
(R):5'- CAATGCCTCATAGCCAAAGATG -3'

Sequencing Primer
(F):5'- CTCTGGGGGCTCCTTTTCG -3'
(R):5'- AACACTGGAGGACATAATCTCC -3'
Posted On2016-10-26