Incidental Mutation 'R5575:Thada'
ID437195
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 043130-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5575 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 84416399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably null
Transcript: ENSMUST00000047524
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Meta Mutation Damage Score 0.6492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 C T 14: 54,678,738 probably null Het
Adrm1 T G 2: 180,175,716 D325E probably benign Het
Anapc4 T A 5: 52,855,871 V433E probably damaging Het
Aplf A C 6: 87,646,147 C338G probably benign Het
Atad5 A G 11: 80,100,323 T681A probably benign Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Catsperg2 T C 7: 29,705,590 K81R possibly damaging Het
Cep170b T A 12: 112,735,632 H286Q probably damaging Het
Cfap61 G A 2: 146,017,393 V434I probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col9a3 A T 2: 180,598,846 probably benign Het
Dsc2 A T 18: 20,035,390 C671S probably damaging Het
Eif5 T C 12: 111,542,306 V245A probably damaging Het
Epha5 G A 5: 84,416,502 R2W probably damaging Het
Fam129a A T 1: 151,718,240 H892L probably benign Het
Gabrb2 G A 11: 42,529,538 probably benign Het
Gm3453 A G 14: 5,978,205 V66A possibly damaging Het
Gna15 T C 10: 81,523,873 I28V probably damaging Het
Hk3 A T 13: 55,014,770 D88E probably damaging Het
Hmbox1 T C 14: 64,823,164 T375A probably benign Het
Ibsp A T 5: 104,310,059 E154V possibly damaging Het
Il7r A G 15: 9,508,187 S350P probably benign Het
Isx T C 8: 74,892,801 L207P probably benign Het
Krt35 T C 11: 100,094,624 E197G probably damaging Het
Krt78 G A 15: 101,947,352 Q675* probably null Het
March1 T A 8: 66,468,310 V217E probably damaging Het
Mertk T C 2: 128,736,565 I157T probably damaging Het
Mmab A T 5: 114,436,771 L147Q probably damaging Het
Ndst4 T A 3: 125,437,830 V16D probably benign Het
Ogdhl T C 14: 32,325,847 L18P possibly damaging Het
Pikfyve A C 1: 65,273,730 H2089P probably damaging Het
Plxna1 A T 6: 89,324,541 L1501Q possibly damaging Het
Ppp2r5c T C 12: 110,552,832 F246S probably damaging Het
Ptbp2 A T 3: 119,720,783 probably null Het
Ptbp2 G A 3: 119,720,789 P463L possibly damaging Het
Rad51 A G 2: 119,134,433 D274G probably benign Het
Ranbp2 T C 10: 58,492,583 V2807A probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rp1l1 C T 14: 64,030,984 H1340Y probably benign Het
Ryr1 T A 7: 29,078,693 H2133L possibly damaging Het
Scgb1c1 G A 7: 140,846,111 G40E probably damaging Het
Shank2 T C 7: 144,410,134 I703T probably damaging Het
Spag17 G A 3: 100,053,822 A975T possibly damaging Het
Supt6 T C 11: 78,228,961 D400G probably damaging Het
Synrg T C 11: 84,009,552 probably null Het
Themis3 A G 17: 66,555,326 S546P possibly damaging Het
Tinf2 T C 14: 55,680,174 D286G probably benign Het
Tmem67 A T 4: 12,047,886 V815D possibly damaging Het
Trpm1 T C 7: 64,220,270 L441P possibly damaging Het
Vapa A G 17: 65,613,252 V16A probably benign Het
Vmn2r38 A T 7: 9,075,636 Y582* probably null Het
Vps13b A T 15: 35,929,919 K3934I probably damaging Het
Wrn G A 8: 33,336,130 T168I probably benign Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATGGTCTGTAGCCTG -3'
(R):5'- GAAATTTGCAAGTCTGGCATAGG -3'

Sequencing Primer
(F):5'- CATGGTCTGTAGCCTGCTCTTAAAAG -3'
(R):5'- GATTACATTGTTCAAGGCCAGCCAG -3'
Posted On2016-10-26