Incidental Mutation 'R5576:Btnl9'
ID437224
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Namebutyrophilin-like 9
Synonyms
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49165585-49187159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49178885 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 189 (H189R)
Ref Sequence ENSEMBL: ENSMUSP00000066598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531] [ENSMUST00000153999]
Predicted Effect probably benign
Transcript: ENSMUST00000046522
AA Change: H189R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283
AA Change: H189R

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066531
AA Change: H189R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: H189R

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128462
Predicted Effect probably benign
Transcript: ENSMUST00000153999
SMART Domains Protein: ENSMUSP00000120530
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
transmembrane domain 165 187 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49175691 missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49180582 missense probably benign 0.00
IGL02129:Btnl9 APN 11 49169273 missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49180798 missense probably benign 0.27
IGL02795:Btnl9 APN 11 49174867 splice site probably benign
IGL02889:Btnl9 APN 11 49178777 missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49169181 missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49178779 missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49169616 missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49175595 missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49180747 missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49169544 missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R2000:Btnl9 UTSW 11 49169121 missense probably benign 0.04
R2068:Btnl9 UTSW 11 49169563 missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49180696 missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49170626 splice site probably null
R2229:Btnl9 UTSW 11 49169118 missense probably damaging 1.00
R2255:Btnl9 UTSW 11 49169316 nonsense probably null
R2386:Btnl9 UTSW 11 49178775 missense probably damaging 1.00
R3177:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49180685 missense probably damaging 1.00
R5287:Btnl9 UTSW 11 49169607 missense probably benign 0.20
R5352:Btnl9 UTSW 11 49178840 missense probably benign 0.01
R5433:Btnl9 UTSW 11 49176003 intron probably benign
R5490:Btnl9 UTSW 11 49169568 missense probably damaging 1.00
R6008:Btnl9 UTSW 11 49182965 critical splice donor site probably null
R6770:Btnl9 UTSW 11 49175565 splice site probably null
R7126:Btnl9 UTSW 11 49169255 missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49175790 missense probably benign 0.06
X0026:Btnl9 UTSW 11 49169241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAAGTGTGAGCCAGTGC -3'
(R):5'- ATTCCTGACATCTTACGGTGC -3'

Sequencing Primer
(F):5'- AGTGCCTACTGACCTGCAATCTG -3'
(R):5'- ATCTTACGGTGCCCTCAGATGG -3'
Posted On2016-10-26