Incidental Mutation 'R5576:Ccdc122'
ID437232
Institutional Source Beutler Lab
Gene Symbol Ccdc122
Ensembl Gene ENSMUSG00000034795
Gene Namecoiled-coil domain containing 122
Synonyms4933415L06Rik
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location77036772-77112257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77091877 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 123 (M123I)
Ref Sequence ENSEMBL: ENSMUSP00000036369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048208] [ENSMUST00000095625] [ENSMUST00000175810]
Predicted Effect probably benign
Transcript: ENSMUST00000048208
AA Change: M123I

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036369
Gene: ENSMUSG00000034795
AA Change: M123I

DomainStartEndE-ValueType
coiled coil region 33 102 N/A INTRINSIC
coiled coil region 152 182 N/A INTRINSIC
coiled coil region 209 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095625
SMART Domains Protein: ENSMUSP00000093285
Gene: ENSMUSG00000034795

DomainStartEndE-ValueType
coiled coil region 68 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175810
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Slfn9 A T 11: 82,981,432 M826K probably benign Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Ccdc122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ccdc122 APN 14 77091739 missense probably benign 0.02
IGL01307:Ccdc122 APN 14 77092076 splice site probably benign
IGL02585:Ccdc122 APN 14 77092762 splice site probably benign
IGL03376:Ccdc122 APN 14 77068912 missense probably damaging 1.00
R0724:Ccdc122 UTSW 14 77092077 splice site probably benign
R0732:Ccdc122 UTSW 14 77091759 missense probably damaging 0.99
R1123:Ccdc122 UTSW 14 77067911 missense probably damaging 1.00
R1528:Ccdc122 UTSW 14 77067939 missense possibly damaging 0.87
R1860:Ccdc122 UTSW 14 77111407 missense probably damaging 1.00
R2072:Ccdc122 UTSW 14 77068951 critical splice donor site probably null
R2074:Ccdc122 UTSW 14 77068951 critical splice donor site probably null
R2075:Ccdc122 UTSW 14 77068951 critical splice donor site probably null
R2421:Ccdc122 UTSW 14 77091663 splice site probably benign
R2442:Ccdc122 UTSW 14 77091958 missense possibly damaging 0.89
R4798:Ccdc122 UTSW 14 77111607 utr 3 prime probably benign
R4973:Ccdc122 UTSW 14 77067941 missense possibly damaging 0.92
R5487:Ccdc122 UTSW 14 77091679 missense probably benign 0.31
R5630:Ccdc122 UTSW 14 77092776 missense probably damaging 1.00
R6502:Ccdc122 UTSW 14 77042069 intron probably null
R6833:Ccdc122 UTSW 14 77088931 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CAAATAGCGACTATTGCTGAAGAAG -3'
(R):5'- ACCTTAGGCATCTGCACATTCAG -3'

Sequencing Primer
(F):5'- GCTAAAGAAACAGACAGGCAAATGC -3'
(R):5'- GGGCTTGACAAGTAGCACTTC -3'
Posted On2016-10-26