Incidental Mutation 'R5577:Acr'
ID 437272
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Name acrosin prepropeptide
Synonyms preproacrosin
MMRRC Submission 043132-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5577 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 89452549-89458790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 89458441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 374 (T374K)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
AlphaFold P23578
Predicted Effect probably benign
Transcript: ENSMUST00000023295
AA Change: T374K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: T374K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230538
Predicted Effect probably benign
Transcript: ENSMUST00000230978
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 127,835,826 (GRCm39) Y256D probably damaging Het
Akt2 G A 7: 27,335,731 (GRCm39) G335R probably damaging Het
Ccn3 T A 15: 54,615,897 (GRCm39) I354N possibly damaging Het
Cd177 A T 7: 24,444,562 (GRCm39) F673Y probably damaging Het
Clmn G T 12: 104,743,329 (GRCm39) S879R probably damaging Het
Csrp3 T C 7: 48,489,225 (GRCm39) H19R possibly damaging Het
Dmkn T C 7: 30,463,971 (GRCm39) S137P probably damaging Het
Eno1 C A 4: 150,331,067 (GRCm39) Y236* probably null Het
Enpp7 T A 11: 118,882,953 (GRCm39) N342K probably benign Het
Fancm T A 12: 65,177,185 (GRCm39) probably benign Het
Fshr A T 17: 89,293,351 (GRCm39) D442E probably benign Het
Gm3898 T A 9: 43,741,362 (GRCm39) noncoding transcript Het
Hdac7 A T 15: 97,709,336 (GRCm39) S43T probably benign Het
Herc1 T C 9: 66,389,263 (GRCm39) C3927R probably damaging Het
Klc4 G T 17: 46,946,355 (GRCm39) A490D probably damaging Het
Lcn9 T A 2: 25,713,663 (GRCm39) I63N probably damaging Het
Lgalsl G A 11: 20,779,316 (GRCm39) Q110* probably null Het
Lrp1b A T 2: 40,765,135 (GRCm39) M2783K possibly damaging Het
Lrrk2 A T 15: 91,649,948 (GRCm39) Y1695F probably damaging Het
Myo1e G A 9: 70,277,753 (GRCm39) E817K probably benign Het
Nav3 A T 10: 109,605,264 (GRCm39) D936E probably damaging Het
Necab3 T C 2: 154,387,076 (GRCm39) probably null Het
Nlrp1a T A 11: 70,990,400 (GRCm39) I951F probably damaging Het
Or5v1 T A 17: 37,810,493 (GRCm39) I317K probably benign Het
Or8b52 A G 9: 38,576,297 (GRCm39) I281T possibly damaging Het
Ppp2r5d T C 17: 46,998,901 (GRCm39) S54G probably benign Het
Prdx6 A G 1: 161,071,255 (GRCm39) S146P probably damaging Het
Sec24a A T 11: 51,625,448 (GRCm39) H258Q probably benign Het
Sec31a T C 5: 100,550,133 (GRCm39) T194A possibly damaging Het
Sqstm1 T C 11: 50,098,266 (GRCm39) I167V probably benign Het
Tas1r3 T C 4: 155,946,522 (GRCm39) E361G probably benign Het
Tlr1 T A 5: 65,083,428 (GRCm39) Q383L possibly damaging Het
Trappc8 G C 18: 20,969,836 (GRCm39) Y1051* probably null Het
Vmn2r2 T A 3: 64,024,416 (GRCm39) M722L probably benign Het
Vmn2r43 T C 7: 8,247,811 (GRCm39) H784R probably damaging Het
Zfp534 T G 4: 147,759,173 (GRCm39) K499Q probably damaging Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89,457,453 (GRCm39) missense probably benign 0.19
IGL00857:Acr APN 15 89,454,205 (GRCm39) missense probably benign 0.00
IGL01353:Acr APN 15 89,453,695 (GRCm39) missense probably damaging 1.00
IGL01466:Acr APN 15 89,458,197 (GRCm39) missense probably benign
IGL01599:Acr APN 15 89,452,617 (GRCm39) missense probably benign 0.01
IGL02408:Acr APN 15 89,454,217 (GRCm39) missense probably damaging 1.00
R0042:Acr UTSW 15 89,458,535 (GRCm39) missense probably benign
R0398:Acr UTSW 15 89,458,144 (GRCm39) missense probably damaging 1.00
R0520:Acr UTSW 15 89,457,430 (GRCm39) missense probably damaging 1.00
R0578:Acr UTSW 15 89,453,678 (GRCm39) missense probably damaging 1.00
R0579:Acr UTSW 15 89,453,678 (GRCm39) missense probably damaging 1.00
R1167:Acr UTSW 15 89,458,177 (GRCm39) missense probably damaging 1.00
R1792:Acr UTSW 15 89,457,346 (GRCm39) missense probably benign 0.00
R2006:Acr UTSW 15 89,458,404 (GRCm39) missense probably benign 0.00
R5531:Acr UTSW 15 89,458,146 (GRCm39) missense probably damaging 1.00
R7033:Acr UTSW 15 89,453,703 (GRCm39) missense probably benign 0.03
R7206:Acr UTSW 15 89,458,374 (GRCm39) missense probably benign
R7484:Acr UTSW 15 89,457,427 (GRCm39) missense probably damaging 0.99
R7548:Acr UTSW 15 89,458,596 (GRCm39) missense possibly damaging 0.72
R8001:Acr UTSW 15 89,458,165 (GRCm39) missense probably damaging 1.00
R8325:Acr UTSW 15 89,453,954 (GRCm39) missense probably benign 0.22
R8852:Acr UTSW 15 89,458,057 (GRCm39) missense probably damaging 1.00
R8860:Acr UTSW 15 89,458,057 (GRCm39) missense probably damaging 1.00
R9683:Acr UTSW 15 89,457,440 (GRCm39) nonsense probably null
Z1177:Acr UTSW 15 89,454,082 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTTGATTCAGCCAGCCAC -3'
(R):5'- TTTTCTCAGGAATGGAGGAAGG -3'

Sequencing Primer
(F):5'- GACTACCCGCCATCCGATG -3'
(R):5'- TGGAGGAAGGGCTCGCTG -3'
Posted On 2016-10-26