Incidental Mutation 'R5578:Taar1'
ID437309
Institutional Source Beutler Lab
Gene Symbol Taar1
Ensembl Gene ENSMUSG00000056379
Gene Nametrace amine-associated receptor 1
SynonymsTrar1, Tar1
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23920356-23921469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23920820 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 139 (I139F)
Ref Sequence ENSEMBL: ENSMUSP00000049527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051532
AA Change: I139F

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049527
Gene: ENSMUSG00000056379
AA Change: I139F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 316 1.4e-11 PFAM
Pfam:7tm_1 39 301 2.4e-62 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation display decreased prepulse inhibition and increased sensitivity to amphetamines. Mice homozygous for another knock-out allele exhibit increased sensitivity to MDMA-induced hyperthermia, brain dopamine and serotonin levels, and induced hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Taar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Taar1 APN 10 23920446 missense probably benign 0.00
R0022:Taar1 UTSW 10 23920727 missense probably benign 0.45
R0126:Taar1 UTSW 10 23920547 missense probably benign 0.00
R0442:Taar1 UTSW 10 23920482 missense possibly damaging 0.80
R0720:Taar1 UTSW 10 23921073 missense probably damaging 1.00
R0931:Taar1 UTSW 10 23921283 missense probably damaging 1.00
R1270:Taar1 UTSW 10 23920533 missense probably damaging 1.00
R1834:Taar1 UTSW 10 23921189 missense probably benign 0.04
R2137:Taar1 UTSW 10 23921270 missense probably benign
R3765:Taar1 UTSW 10 23921307 missense probably damaging 1.00
R3873:Taar1 UTSW 10 23920584 missense probably damaging 1.00
R5334:Taar1 UTSW 10 23920545 missense probably damaging 1.00
R5418:Taar1 UTSW 10 23921316 missense possibly damaging 0.91
R7048:Taar1 UTSW 10 23920824 missense probably benign 0.40
R7096:Taar1 UTSW 10 23920911 missense possibly damaging 0.48
R7163:Taar1 UTSW 10 23921020 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGGCCATTGTCGACTTTCTG -3'
(R):5'- GGAAGTCATGAACGCCAGTACC -3'

Sequencing Primer
(F):5'- GCTGTCTGATAATGCCCTGCAG -3'
(R):5'- CCCCAGATACTTTACTAAAGAAGGG -3'
Posted On2016-10-26