Incidental Mutation 'R5589:Rrbp1'
ID437331
Institutional Source Beutler Lab
Gene Symbol Rrbp1
Ensembl Gene ENSMUSG00000027422
Gene Nameribosome binding protein 1
SynonymsmRRp15b, mRRp47, mRRp41, 5730465C04Rik, 1700087N07Rik, mRRp0, mRRp15a, mRRp16.8, mRRp10, mRRp5.4, ES/130, mRRp2, mRRp1.8, p180
MMRRC Submission 043142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5589 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location143947395-144011263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143989966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000016072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016072] [ENSMUST00000037875]
Predicted Effect probably benign
Transcript: ENSMUST00000016072
AA Change: I94V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000016072
Gene: ENSMUSG00000027422
AA Change: I94V

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 171 2.3e-40 PFAM
low complexity region 197 215 N/A INTRINSIC
internal_repeat_2 218 373 2.94e-114 PROSPERO
internal_repeat_1 219 406 7.79e-148 PROSPERO
internal_repeat_1 410 618 7.79e-148 PROSPERO
internal_repeat_2 449 692 2.94e-114 PROSPERO
coiled coil region 757 1126 N/A INTRINSIC
coiled coil region 1167 1321 N/A INTRINSIC
coiled coil region 1342 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037875
AA Change: I94V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040560
Gene: ENSMUSG00000027422
AA Change: I94V

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 173 2.8e-47 PFAM
low complexity region 197 215 N/A INTRINSIC
Blast:KISc 470 652 3e-13 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,066 M76L probably benign Het
Alg1 T A 16: 5,235,222 W116R probably benign Het
Ano3 A T 2: 110,884,995 S33T probably damaging Het
Atp2b2 T C 6: 113,774,439 E556G possibly damaging Het
BC067074 A G 13: 113,317,950 R177G possibly damaging Het
Brca2 T A 5: 150,557,132 I2761K possibly damaging Het
Ccdc68 G A 18: 69,946,506 G141E probably benign Het
Cckbr T C 7: 105,434,525 V220A probably damaging Het
Ccnd3 G A 17: 47,598,619 R45Q probably damaging Het
Cdh24 G T 14: 54,637,375 T391N probably damaging Het
Cldn11 A G 3: 31,150,246 T33A probably damaging Het
Clec2e T A 6: 129,098,428 Y50F probably benign Het
Cntnap1 A G 11: 101,185,118 N943D probably benign Het
Dmgdh T C 13: 93,677,157 V70A probably damaging Het
Gm14496 C A 2: 181,995,881 Y249* probably null Het
Gm9774 T A 3: 92,428,805 probably benign Het
Gmnc T A 16: 26,962,964 H105L probably damaging Het
Gpt2 A G 8: 85,493,111 Y62C probably damaging Het
Ift80 T C 3: 68,930,900 R413G probably damaging Het
Kctd16 C A 18: 40,259,008 D216E probably damaging Het
Kif26b T C 1: 178,916,299 V873A probably benign Het
Klra4 G T 6: 130,062,154 Q92K probably benign Het
L1td1 C A 4: 98,738,104 N845K possibly damaging Het
Lama3 C T 18: 12,472,220 T1077I possibly damaging Het
Loxhd1 T C 18: 77,342,055 I230T possibly damaging Het
Lsg1 T C 16: 30,581,001 N160S probably damaging Het
Lyzl4 G A 9: 121,584,403 R24C probably damaging Het
Mib1 A G 18: 10,794,488 N658S probably benign Het
Mmp8 T C 9: 7,566,274 I377T probably damaging Het
Mtmr14 T C 6: 113,261,282 probably null Het
Myo1c A G 11: 75,657,588 T58A possibly damaging Het
Myo9a C T 9: 59,895,244 Q2005* probably null Het
Neu3 G T 7: 99,823,429 P34T probably benign Het
Nlrp4b G A 7: 10,715,585 V205I probably benign Het
Olfr1095 A G 2: 86,850,774 I308T unknown Het
Olfr1154 T C 2: 87,903,347 T110A probably benign Het
Olfr1272 C T 2: 90,281,969 G202D probably damaging Het
Olfr1282 T C 2: 111,335,505 N191S possibly damaging Het
Olfr191 A T 16: 59,085,971 S171T probably benign Het
Olfr798 T G 10: 129,625,450 T204P probably damaging Het
Pcsk6 T C 7: 65,929,185 probably null Het
Pik3c2a A G 7: 116,417,658 V288A probably benign Het
Plcd3 T C 11: 103,077,803 D354G probably benign Het
Prkdc C A 16: 15,706,791 N1219K probably benign Het
Prl3d1 T A 13: 27,094,944 Y41N probably damaging Het
Qrich2 C T 11: 116,441,408 G2321R probably damaging Het
Serinc1 C A 10: 57,523,166 V214L probably benign Het
Serpina9 G T 12: 104,001,469 N222K probably benign Het
Smchd1 A G 17: 71,440,961 Y429H probably damaging Het
Smyd1 C T 6: 71,262,180 V9M probably damaging Het
Sostdc1 C T 12: 36,317,247 Q141* probably null Het
Spam1 C T 6: 24,796,110 T20I probably benign Het
Tex47 T C 5: 7,304,834 V5A probably benign Het
Thbs4 T C 13: 92,776,074 probably null Het
Trim45 C T 3: 100,929,941 P531L probably damaging Het
Tshb A T 3: 102,778,162 Y50* probably null Het
Ttn T C 2: 76,768,976 I19230V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba6 G A 5: 86,122,429 T832I probably damaging Het
Unc13d A T 11: 116,069,753 V497D probably damaging Het
Usp13 T C 3: 32,837,858 V62A probably damaging Het
Vmn1r215 A C 13: 23,076,019 L76F probably damaging Het
Vmn1r215 G T 13: 23,076,020 G77C probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zbtb40 T C 4: 136,995,283 D828G probably damaging Het
Zfp74 A T 7: 29,934,565 C573S probably damaging Het
Other mutations in Rrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Rrbp1 APN 2 143968618 missense possibly damaging 0.93
IGL01636:Rrbp1 APN 2 143947895 unclassified probably benign
IGL01923:Rrbp1 APN 2 143990161 missense probably damaging 1.00
IGL02513:Rrbp1 APN 2 143988430 missense possibly damaging 0.55
IGL02548:Rrbp1 APN 2 143949759 splice site probably benign
IGL02678:Rrbp1 APN 2 143990187 missense probably damaging 0.98
FR4449:Rrbp1 UTSW 2 143967456 frame shift probably null
PIT4378001:Rrbp1 UTSW 2 143974540 missense probably benign 0.00
R0127:Rrbp1 UTSW 2 143989944 missense probably benign 0.21
R0611:Rrbp1 UTSW 2 143988516 missense probably damaging 1.00
R0881:Rrbp1 UTSW 2 143953253 missense probably benign 0.09
R1439:Rrbp1 UTSW 2 143955112 critical splice donor site probably null
R1534:Rrbp1 UTSW 2 143988313 missense probably damaging 1.00
R1604:Rrbp1 UTSW 2 143989390 missense probably damaging 0.99
R1920:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R1921:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R2152:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2153:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2319:Rrbp1 UTSW 2 143957559 missense probably benign 0.01
R2850:Rrbp1 UTSW 2 143949349 missense probably benign 0.09
R2864:Rrbp1 UTSW 2 143957637 missense probably damaging 0.99
R3433:Rrbp1 UTSW 2 143952280 splice site probably benign
R3707:Rrbp1 UTSW 2 143953277 missense probably benign 0.01
R3837:Rrbp1 UTSW 2 143989558 missense probably damaging 1.00
R4073:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4074:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4076:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4279:Rrbp1 UTSW 2 143963108 missense probably benign 0.16
R4583:Rrbp1 UTSW 2 143988751 missense probably benign 0.03
R4820:Rrbp1 UTSW 2 143964765 missense possibly damaging 0.78
R4829:Rrbp1 UTSW 2 143989687 missense probably benign 0.18
R4836:Rrbp1 UTSW 2 143988417 missense possibly damaging 0.75
R5801:Rrbp1 UTSW 2 143989783 missense probably damaging 1.00
R5806:Rrbp1 UTSW 2 143963331 missense probably benign 0.16
R5955:Rrbp1 UTSW 2 143949677 missense probably benign 0.06
R6102:Rrbp1 UTSW 2 143988393 missense probably damaging 1.00
R6368:Rrbp1 UTSW 2 143989555 missense probably damaging 1.00
R6916:Rrbp1 UTSW 2 143974598 missense probably benign 0.03
R7022:Rrbp1 UTSW 2 143957802 intron probably null
R7061:Rrbp1 UTSW 2 143989167 missense possibly damaging 0.61
R7136:Rrbp1 UTSW 2 143949680 missense probably benign 0.16
R7291:Rrbp1 UTSW 2 143969462 missense probably benign 0.09
R7361:Rrbp1 UTSW 2 143967444 missense probably benign 0.01
Z1088:Rrbp1 UTSW 2 143974486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACTTTGAAGCAAGAACC -3'
(R):5'- AGACGTCGTATGAAGAAGCCC -3'

Sequencing Primer
(F):5'- ATAGAACTGACTGCTGGCTC -3'
(R):5'- TCGTATGAAGAAGCCCTTGCC -3'
Posted On2016-10-26