Incidental Mutation 'R5590:Trrap'
ID437424
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 043143-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5590 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144782265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably benign
Transcript: ENSMUST00000038980
AA Change: I193V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: I193V

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094120
AA Change: I193V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: I193V

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100467
AA Change: I193V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: I193V

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132925
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136379
Predicted Effect probably benign
Transcript: ENSMUST00000213013
AA Change: I193V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,472 S189P possibly damaging Het
3100002H09Rik T G 4: 124,610,487 M91L unknown Het
A2m C T 6: 121,676,932 T1408M probably damaging Het
Abca16 C T 7: 120,544,772 T1671M probably damaging Het
Adamts8 A T 9: 30,951,336 N279I probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Aldh4a1 T A 4: 139,642,104 V322E probably damaging Het
Atp12a A T 14: 56,373,380 Y327F probably benign Het
C4b T C 17: 34,740,335 T422A probably damaging Het
Cacna1c A T 6: 118,687,182 S668T probably damaging Het
Cchcr1 A T 17: 35,526,680 E426D probably damaging Het
Ccr3 G A 9: 124,028,793 G55D probably damaging Het
Cdipt T A 7: 126,979,532 probably null Het
Cep19 A G 16: 32,103,898 probably benign Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cyp3a11 C A 5: 145,865,977 M235I probably benign Het
Dnajc21 A T 15: 10,462,277 D87E possibly damaging Het
Ell A C 8: 70,539,707 M1L possibly damaging Het
Esyt3 T C 9: 99,358,413 probably benign Het
Ets1 T C 9: 32,728,798 probably benign Het
Fam222b T A 11: 78,155,032 M473K probably benign Het
Fanca T C 8: 123,303,963 probably benign Het
Fbrsl1 G T 5: 110,381,618 A67D probably damaging Het
Fchsd1 G A 18: 37,961,327 P622L probably damaging Het
Gal3st2c T G 1: 94,008,301 probably null Het
Gins2 T G 8: 120,581,747 H166P possibly damaging Het
Gm10118 A T 10: 63,927,066 probably benign Het
Gm9979 A T 13: 40,705,813 noncoding transcript Het
Hspbap1 A G 16: 35,801,663 Y126C probably damaging Het
Hspd1 A T 1: 55,084,769 I64N probably damaging Het
Igkv3-4 A T 6: 70,672,283 S89C probably damaging Het
Il10ra T A 9: 45,265,626 K134* probably null Het
Il12rb1 G A 8: 70,813,767 C252Y possibly damaging Het
Il24 A T 1: 130,882,516 V201E possibly damaging Het
Inpp1 A G 1: 52,794,661 I92T probably damaging Het
Kcnh5 T C 12: 74,976,689 D535G probably benign Het
Kcnq4 T A 4: 120,715,885 I240F probably damaging Het
Kctd17 G A 15: 78,437,302 probably benign Het
Leo1 T A 9: 75,457,141 I521N possibly damaging Het
Mdga1 A G 17: 29,839,867 L722P probably damaging Het
Met G T 6: 17,548,782 V942L probably benign Het
Mfn1 A T 3: 32,563,847 T110S probably benign Het
Mrps15 T C 4: 126,048,695 I79T probably benign Het
Mycbp2 A C 14: 103,123,355 M4497R probably damaging Het
Mylk T A 16: 34,879,352 S362T probably benign Het
Mypn A G 10: 63,120,048 F1209L probably benign Het
Nab2 T C 10: 127,664,657 S189G probably damaging Het
Naxe A C 3: 88,056,533 probably null Het
Ncf1 A G 5: 134,223,501 V232A probably damaging Het
Nell1 A G 7: 50,279,611 Y422C probably damaging Het
Nmnat2 G T 1: 153,094,061 G176V probably damaging Het
Npr1 A G 3: 90,454,842 S999P probably damaging Het
Nuak1 T C 10: 84,375,255 D323G probably benign Het
Olfr1424 A G 19: 12,059,278 V158A probably benign Het
Olfr191 A G 16: 59,085,997 F162S probably benign Het
Olfr918 T A 9: 38,672,965 T160S probably damaging Het
Osbpl8 T C 10: 111,272,168 S342P probably damaging Het
Pag1 A T 3: 9,699,422 Y224N probably damaging Het
Pald1 T A 10: 61,343,710 H460L probably damaging Het
Per2 G A 1: 91,427,856 Q727* probably null Het
Pex19 T C 1: 172,133,212 V134A probably benign Het
Phlpp1 A T 1: 106,392,927 I1551F possibly damaging Het
Ppef2 A T 5: 92,239,139 V313D probably damaging Het
Pzp A C 6: 128,523,796 F153C probably damaging Het
Rasl11a A G 5: 146,845,242 H9R probably benign Het
Rfx3 A T 19: 27,802,380 probably null Het
Rmnd5b A T 11: 51,627,962 I68N probably damaging Het
Senp5 T A 16: 31,989,513 S281C probably damaging Het
Sh3rf1 G A 8: 61,361,732 E442K probably benign Het
Slc12a3 G A 8: 94,345,788 V645M probably damaging Het
Slc22a16 T C 10: 40,581,341 F193L possibly damaging Het
Slc35f1 A T 10: 53,108,178 T345S possibly damaging Het
Slc9a1 G A 4: 133,421,563 R704H probably damaging Het
Spta1 A T 1: 174,175,770 Y89F possibly damaging Het
Sspo A G 6: 48,474,491 E2741G probably damaging Het
Strn4 G A 7: 16,833,874 probably null Het
Tanc2 A G 11: 105,923,306 T1859A probably damaging Het
Tbc1d14 A T 5: 36,525,045 Y3N probably damaging Het
Tdrd9 C A 12: 112,051,980 R1278S probably benign Het
Tenm4 G T 7: 96,797,400 A826S possibly damaging Het
Tenm4 C A 7: 96,797,401 A826E possibly damaging Het
Tet2 C T 3: 133,476,480 probably null Het
Tfec A G 6: 16,834,200 L236P probably benign Het
Tjap1 A G 17: 46,258,871 S388P probably damaging Het
Tle1 T C 4: 72,124,971 T554A possibly damaging Het
Tmem17 G A 11: 22,517,450 V83I probably benign Het
Tnrc6b C T 15: 80,876,502 H137Y probably damaging Het
Tomm5 T C 4: 45,106,679 probably benign Het
Top3b T A 16: 16,891,577 probably benign Het
Tph1 T C 7: 46,653,792 H254R probably damaging Het
Tpte T C 8: 22,351,452 Y487H probably damaging Het
Trappc13 T A 13: 104,148,241 D241V probably damaging Het
Tspear A T 10: 77,870,365 H323L probably benign Het
Ttc39a A T 4: 109,432,987 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubg1 A G 11: 101,124,032 D200G probably damaging Het
Ugdh C A 5: 65,422,874 probably benign Het
Uso1 A G 5: 92,180,608 N355D probably benign Het
Vamp4 T C 1: 162,592,679 probably null Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vps52 A G 17: 33,961,221 T300A probably benign Het
Wt1 A T 2: 105,127,284 H163L probably damaging Het
Xirp2 T C 2: 67,514,035 S2207P probably benign Het
Xpo6 A T 7: 126,107,078 I30N probably damaging Het
Zfp386 T A 12: 116,059,727 I320K probably benign Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAAAAGTAGTGGTATGTGTCTG -3'
(R):5'- TCCAAACGCTCTAAGTTACCTC -3'

Sequencing Primer
(F):5'- ATCACCTTTCCTAATTTGGGGTAG -3'
(R):5'- CATTCTTCCCTCTGGCAAATGAGAG -3'
Posted On2016-10-26