Incidental Mutation 'R5590:Atp12a'
ID437479
Institutional Source Beutler Lab
Gene Symbol Atp12a
Ensembl Gene ENSMUSG00000022229
Gene NameATPase, H+/K+ transporting, nongastric, alpha polypeptide
SynonymscHKA, ATPase H+K+-transporting, alpha 2, Atp1al1, HKalpha2
MMRRC Submission 043143-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5590 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56365068-56388550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56373380 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 327 (Y327F)
Ref Sequence ENSEMBL: ENSMUSP00000007340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007340]
Predicted Effect probably benign
Transcript: ENSMUST00000007340
AA Change: Y327F

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000007340
Gene: ENSMUSG00000022229
AA Change: Y327F

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 54 128 9.27e-15 SMART
Pfam:E1-E2_ATPase 145 376 9.8e-57 PFAM
Pfam:Hydrolase 381 740 7.8e-20 PFAM
Pfam:HAD 384 737 7.6e-19 PFAM
Pfam:Cation_ATPase 437 532 3.4e-26 PFAM
Pfam:Cation_ATPase_C 810 1020 9.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225698
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased potassium excretion. When placed on a potassium-free diet, mutant animals display greater weight loss and slightly increased kidney weight compared to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,472 S189P possibly damaging Het
3100002H09Rik T G 4: 124,610,487 M91L unknown Het
A2m C T 6: 121,676,932 T1408M probably damaging Het
Abca16 C T 7: 120,544,772 T1671M probably damaging Het
Adamts8 A T 9: 30,951,336 N279I probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Aldh4a1 T A 4: 139,642,104 V322E probably damaging Het
C4b T C 17: 34,740,335 T422A probably damaging Het
Cacna1c A T 6: 118,687,182 S668T probably damaging Het
Cchcr1 A T 17: 35,526,680 E426D probably damaging Het
Ccr3 G A 9: 124,028,793 G55D probably damaging Het
Cdipt T A 7: 126,979,532 probably null Het
Cep19 A G 16: 32,103,898 probably benign Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cyp3a11 C A 5: 145,865,977 M235I probably benign Het
Dnajc21 A T 15: 10,462,277 D87E possibly damaging Het
Ell A C 8: 70,539,707 M1L possibly damaging Het
Esyt3 T C 9: 99,358,413 probably benign Het
Ets1 T C 9: 32,728,798 probably benign Het
Fam222b T A 11: 78,155,032 M473K probably benign Het
Fanca T C 8: 123,303,963 probably benign Het
Fbrsl1 G T 5: 110,381,618 A67D probably damaging Het
Fchsd1 G A 18: 37,961,327 P622L probably damaging Het
Gal3st2c T G 1: 94,008,301 probably null Het
Gins2 T G 8: 120,581,747 H166P possibly damaging Het
Gm10118 A T 10: 63,927,066 probably benign Het
Gm9979 A T 13: 40,705,813 noncoding transcript Het
Hspbap1 A G 16: 35,801,663 Y126C probably damaging Het
Hspd1 A T 1: 55,084,769 I64N probably damaging Het
Igkv3-4 A T 6: 70,672,283 S89C probably damaging Het
Il10ra T A 9: 45,265,626 K134* probably null Het
Il12rb1 G A 8: 70,813,767 C252Y possibly damaging Het
Il24 A T 1: 130,882,516 V201E possibly damaging Het
Inpp1 A G 1: 52,794,661 I92T probably damaging Het
Kcnh5 T C 12: 74,976,689 D535G probably benign Het
Kcnq4 T A 4: 120,715,885 I240F probably damaging Het
Kctd17 G A 15: 78,437,302 probably benign Het
Leo1 T A 9: 75,457,141 I521N possibly damaging Het
Mdga1 A G 17: 29,839,867 L722P probably damaging Het
Met G T 6: 17,548,782 V942L probably benign Het
Mfn1 A T 3: 32,563,847 T110S probably benign Het
Mrps15 T C 4: 126,048,695 I79T probably benign Het
Mycbp2 A C 14: 103,123,355 M4497R probably damaging Het
Mylk T A 16: 34,879,352 S362T probably benign Het
Mypn A G 10: 63,120,048 F1209L probably benign Het
Nab2 T C 10: 127,664,657 S189G probably damaging Het
Naxe A C 3: 88,056,533 probably null Het
Ncf1 A G 5: 134,223,501 V232A probably damaging Het
Nell1 A G 7: 50,279,611 Y422C probably damaging Het
Nmnat2 G T 1: 153,094,061 G176V probably damaging Het
Npr1 A G 3: 90,454,842 S999P probably damaging Het
Nuak1 T C 10: 84,375,255 D323G probably benign Het
Olfr1424 A G 19: 12,059,278 V158A probably benign Het
Olfr191 A G 16: 59,085,997 F162S probably benign Het
Olfr918 T A 9: 38,672,965 T160S probably damaging Het
Osbpl8 T C 10: 111,272,168 S342P probably damaging Het
Pag1 A T 3: 9,699,422 Y224N probably damaging Het
Pald1 T A 10: 61,343,710 H460L probably damaging Het
Per2 G A 1: 91,427,856 Q727* probably null Het
Pex19 T C 1: 172,133,212 V134A probably benign Het
Phlpp1 A T 1: 106,392,927 I1551F possibly damaging Het
Ppef2 A T 5: 92,239,139 V313D probably damaging Het
Pzp A C 6: 128,523,796 F153C probably damaging Het
Rasl11a A G 5: 146,845,242 H9R probably benign Het
Rfx3 A T 19: 27,802,380 probably null Het
Rmnd5b A T 11: 51,627,962 I68N probably damaging Het
Senp5 T A 16: 31,989,513 S281C probably damaging Het
Sh3rf1 G A 8: 61,361,732 E442K probably benign Het
Slc12a3 G A 8: 94,345,788 V645M probably damaging Het
Slc22a16 T C 10: 40,581,341 F193L possibly damaging Het
Slc35f1 A T 10: 53,108,178 T345S possibly damaging Het
Slc9a1 G A 4: 133,421,563 R704H probably damaging Het
Spta1 A T 1: 174,175,770 Y89F possibly damaging Het
Sspo A G 6: 48,474,491 E2741G probably damaging Het
Strn4 G A 7: 16,833,874 probably null Het
Tanc2 A G 11: 105,923,306 T1859A probably damaging Het
Tbc1d14 A T 5: 36,525,045 Y3N probably damaging Het
Tdrd9 C A 12: 112,051,980 R1278S probably benign Het
Tenm4 G T 7: 96,797,400 A826S possibly damaging Het
Tenm4 C A 7: 96,797,401 A826E possibly damaging Het
Tet2 C T 3: 133,476,480 probably null Het
Tfec A G 6: 16,834,200 L236P probably benign Het
Tjap1 A G 17: 46,258,871 S388P probably damaging Het
Tle1 T C 4: 72,124,971 T554A possibly damaging Het
Tmem17 G A 11: 22,517,450 V83I probably benign Het
Tnrc6b C T 15: 80,876,502 H137Y probably damaging Het
Tomm5 T C 4: 45,106,679 probably benign Het
Top3b T A 16: 16,891,577 probably benign Het
Tph1 T C 7: 46,653,792 H254R probably damaging Het
Tpte T C 8: 22,351,452 Y487H probably damaging Het
Trappc13 T A 13: 104,148,241 D241V probably damaging Het
Trrap A G 5: 144,782,265 I193V probably benign Het
Tspear A T 10: 77,870,365 H323L probably benign Het
Ttc39a A T 4: 109,432,987 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubg1 A G 11: 101,124,032 D200G probably damaging Het
Ugdh C A 5: 65,422,874 probably benign Het
Uso1 A G 5: 92,180,608 N355D probably benign Het
Vamp4 T C 1: 162,592,679 probably null Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vps52 A G 17: 33,961,221 T300A probably benign Het
Wt1 A T 2: 105,127,284 H163L probably damaging Het
Xirp2 T C 2: 67,514,035 S2207P probably benign Het
Xpo6 A T 7: 126,107,078 I30N probably damaging Het
Zfp386 T A 12: 116,059,727 I320K probably benign Het
Other mutations in Atp12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Atp12a APN 14 56379955 missense probably damaging 1.00
IGL02108:Atp12a APN 14 56384068 missense possibly damaging 0.95
IGL02176:Atp12a APN 14 56387179 missense probably damaging 1.00
IGL02210:Atp12a APN 14 56371744 nonsense probably null
IGL02828:Atp12a APN 14 56376142 missense possibly damaging 0.72
IGL02868:Atp12a APN 14 56384182 missense probably damaging 1.00
IGL02876:Atp12a APN 14 56373289 missense probably benign 0.00
R0045:Atp12a UTSW 14 56372873 missense probably damaging 1.00
R0172:Atp12a UTSW 14 56372844 missense probably damaging 1.00
R0276:Atp12a UTSW 14 56387694 missense probably damaging 1.00
R0613:Atp12a UTSW 14 56374521 missense probably damaging 1.00
R0656:Atp12a UTSW 14 56374481 missense probably damaging 1.00
R0962:Atp12a UTSW 14 56368413 missense probably damaging 1.00
R1067:Atp12a UTSW 14 56373436 missense probably damaging 1.00
R1448:Atp12a UTSW 14 56385839 missense probably damaging 1.00
R1503:Atp12a UTSW 14 56373424 missense probably damaging 1.00
R1590:Atp12a UTSW 14 56380055 missense probably damaging 1.00
R1639:Atp12a UTSW 14 56384068 missense possibly damaging 0.95
R1660:Atp12a UTSW 14 56370848 missense probably benign 0.21
R1696:Atp12a UTSW 14 56366088 missense probably damaging 1.00
R1775:Atp12a UTSW 14 56372589 missense probably benign 0.23
R1920:Atp12a UTSW 14 56386851 missense probably benign 0.19
R2022:Atp12a UTSW 14 56365282 start codon destroyed probably null
R2071:Atp12a UTSW 14 56366009 missense probably benign
R2253:Atp12a UTSW 14 56376258 missense probably benign 0.03
R2289:Atp12a UTSW 14 56373262 missense possibly damaging 0.93
R2567:Atp12a UTSW 14 56386927 missense probably damaging 1.00
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2873:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2923:Atp12a UTSW 14 56374622 missense probably benign
R3736:Atp12a UTSW 14 56374427 missense possibly damaging 0.90
R3754:Atp12a UTSW 14 56372588 missense probably benign 0.01
R5028:Atp12a UTSW 14 56386978 missense probably damaging 0.96
R5267:Atp12a UTSW 14 56384211 missense probably damaging 1.00
R5481:Atp12a UTSW 14 56373389 missense possibly damaging 0.90
R5842:Atp12a UTSW 14 56378290 missense probably damaging 0.96
R5899:Atp12a UTSW 14 56373344 missense probably benign 0.44
R5985:Atp12a UTSW 14 56384341 missense probably damaging 1.00
R6044:Atp12a UTSW 14 56376155 missense probably damaging 1.00
R6271:Atp12a UTSW 14 56378422 missense probably benign 0.00
R6454:Atp12a UTSW 14 56370833 missense probably benign 0.02
R6461:Atp12a UTSW 14 56373238 missense probably damaging 1.00
R6610:Atp12a UTSW 14 56374556 missense probably damaging 1.00
R6666:Atp12a UTSW 14 56373364 missense probably benign 0.36
R6667:Atp12a UTSW 14 56384188 missense possibly damaging 0.82
R6677:Atp12a UTSW 14 56380854 missense probably damaging 1.00
R6791:Atp12a UTSW 14 56386982 critical splice donor site probably null
R7003:Atp12a UTSW 14 56373380 missense possibly damaging 0.87
R7173:Atp12a UTSW 14 56384380 missense probably damaging 1.00
X0004:Atp12a UTSW 14 56378467 missense probably benign 0.16
Z1088:Atp12a UTSW 14 56386141 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AATGTCTTCTTCCCTGCAGG -3'
(R):5'- AACAGGCCCATAGTGGTCTCTG -3'

Sequencing Primer
(F):5'- TGGCATTGTCATCAACACGG -3'
(R):5'- CCCATAGTGGTCTCTGGAGGG -3'
Posted On2016-10-26