Incidental Mutation 'R5590:Mycbp2'
ID437480
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene NameMYC binding protein 2
SynonymsC130061D10Rik, Phr1, Pam
MMRRC Submission 043143-MU
Accession Numbers

Genbank: NM_207215; MGI: 2179432

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5590 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103113411-103346814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103123355 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 4497 (M4497R)
Ref Sequence ENSEMBL: ENSMUSP00000124710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
Predicted Effect probably damaging
Transcript: ENSMUST00000159855
AA Change: M4497R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: M4497R

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160758
AA Change: M4387R

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: M4387R

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161008
AA Change: M1213R
SMART Domains Protein: ENSMUSP00000124443
Gene: ENSMUSG00000033004
AA Change: M1213R

DomainStartEndE-ValueType
low complexity region 66 79 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
low complexity region 392 409 N/A INTRINSIC
APC10 524 682 1.11e-18 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
Blast:BBOX 1042 1085 2e-6 BLAST
RING 1213 1263 5.35e-5 SMART
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (108/108)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,472 S189P possibly damaging Het
3100002H09Rik T G 4: 124,610,487 M91L unknown Het
A2m C T 6: 121,676,932 T1408M probably damaging Het
Abca16 C T 7: 120,544,772 T1671M probably damaging Het
Adamts8 A T 9: 30,951,336 N279I probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Aldh4a1 T A 4: 139,642,104 V322E probably damaging Het
Atp12a A T 14: 56,373,380 Y327F probably benign Het
C4b T C 17: 34,740,335 T422A probably damaging Het
Cacna1c A T 6: 118,687,182 S668T probably damaging Het
Cchcr1 A T 17: 35,526,680 E426D probably damaging Het
Ccr3 G A 9: 124,028,793 G55D probably damaging Het
Cdipt T A 7: 126,979,532 probably null Het
Cep19 A G 16: 32,103,898 probably benign Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cyp3a11 C A 5: 145,865,977 M235I probably benign Het
Dnajc21 A T 15: 10,462,277 D87E possibly damaging Het
Ell A C 8: 70,539,707 M1L possibly damaging Het
Esyt3 T C 9: 99,358,413 probably benign Het
Ets1 T C 9: 32,728,798 probably benign Het
Fam222b T A 11: 78,155,032 M473K probably benign Het
Fanca T C 8: 123,303,963 probably benign Het
Fbrsl1 G T 5: 110,381,618 A67D probably damaging Het
Fchsd1 G A 18: 37,961,327 P622L probably damaging Het
Gal3st2c T G 1: 94,008,301 probably null Het
Gins2 T G 8: 120,581,747 H166P possibly damaging Het
Gm10118 A T 10: 63,927,066 probably benign Het
Gm9979 A T 13: 40,705,813 noncoding transcript Het
Hspbap1 A G 16: 35,801,663 Y126C probably damaging Het
Hspd1 A T 1: 55,084,769 I64N probably damaging Het
Igkv3-4 A T 6: 70,672,283 S89C probably damaging Het
Il10ra T A 9: 45,265,626 K134* probably null Het
Il12rb1 G A 8: 70,813,767 C252Y possibly damaging Het
Il24 A T 1: 130,882,516 V201E possibly damaging Het
Inpp1 A G 1: 52,794,661 I92T probably damaging Het
Kcnh5 T C 12: 74,976,689 D535G probably benign Het
Kcnq4 T A 4: 120,715,885 I240F probably damaging Het
Kctd17 G A 15: 78,437,302 probably benign Het
Leo1 T A 9: 75,457,141 I521N possibly damaging Het
Mdga1 A G 17: 29,839,867 L722P probably damaging Het
Met G T 6: 17,548,782 V942L probably benign Het
Mfn1 A T 3: 32,563,847 T110S probably benign Het
Mrps15 T C 4: 126,048,695 I79T probably benign Het
Mylk T A 16: 34,879,352 S362T probably benign Het
Mypn A G 10: 63,120,048 F1209L probably benign Het
Nab2 T C 10: 127,664,657 S189G probably damaging Het
Naxe A C 3: 88,056,533 probably null Het
Ncf1 A G 5: 134,223,501 V232A probably damaging Het
Nell1 A G 7: 50,279,611 Y422C probably damaging Het
Nmnat2 G T 1: 153,094,061 G176V probably damaging Het
Npr1 A G 3: 90,454,842 S999P probably damaging Het
Nuak1 T C 10: 84,375,255 D323G probably benign Het
Olfr1424 A G 19: 12,059,278 V158A probably benign Het
Olfr191 A G 16: 59,085,997 F162S probably benign Het
Olfr918 T A 9: 38,672,965 T160S probably damaging Het
Osbpl8 T C 10: 111,272,168 S342P probably damaging Het
Pag1 A T 3: 9,699,422 Y224N probably damaging Het
Pald1 T A 10: 61,343,710 H460L probably damaging Het
Per2 G A 1: 91,427,856 Q727* probably null Het
Pex19 T C 1: 172,133,212 V134A probably benign Het
Phlpp1 A T 1: 106,392,927 I1551F possibly damaging Het
Ppef2 A T 5: 92,239,139 V313D probably damaging Het
Pzp A C 6: 128,523,796 F153C probably damaging Het
Rasl11a A G 5: 146,845,242 H9R probably benign Het
Rfx3 A T 19: 27,802,380 probably null Het
Rmnd5b A T 11: 51,627,962 I68N probably damaging Het
Senp5 T A 16: 31,989,513 S281C probably damaging Het
Sh3rf1 G A 8: 61,361,732 E442K probably benign Het
Slc12a3 G A 8: 94,345,788 V645M probably damaging Het
Slc22a16 T C 10: 40,581,341 F193L possibly damaging Het
Slc35f1 A T 10: 53,108,178 T345S possibly damaging Het
Slc9a1 G A 4: 133,421,563 R704H probably damaging Het
Spta1 A T 1: 174,175,770 Y89F possibly damaging Het
Sspo A G 6: 48,474,491 E2741G probably damaging Het
Strn4 G A 7: 16,833,874 probably null Het
Tanc2 A G 11: 105,923,306 T1859A probably damaging Het
Tbc1d14 A T 5: 36,525,045 Y3N probably damaging Het
Tdrd9 C A 12: 112,051,980 R1278S probably benign Het
Tenm4 G T 7: 96,797,400 A826S possibly damaging Het
Tenm4 C A 7: 96,797,401 A826E possibly damaging Het
Tet2 C T 3: 133,476,480 probably null Het
Tfec A G 6: 16,834,200 L236P probably benign Het
Tjap1 A G 17: 46,258,871 S388P probably damaging Het
Tle1 T C 4: 72,124,971 T554A possibly damaging Het
Tmem17 G A 11: 22,517,450 V83I probably benign Het
Tnrc6b C T 15: 80,876,502 H137Y probably damaging Het
Tomm5 T C 4: 45,106,679 probably benign Het
Top3b T A 16: 16,891,577 probably benign Het
Tph1 T C 7: 46,653,792 H254R probably damaging Het
Tpte T C 8: 22,351,452 Y487H probably damaging Het
Trappc13 T A 13: 104,148,241 D241V probably damaging Het
Trrap A G 5: 144,782,265 I193V probably benign Het
Tspear A T 10: 77,870,365 H323L probably benign Het
Ttc39a A T 4: 109,432,987 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubg1 A G 11: 101,124,032 D200G probably damaging Het
Ugdh C A 5: 65,422,874 probably benign Het
Uso1 A G 5: 92,180,608 N355D probably benign Het
Vamp4 T C 1: 162,592,679 probably null Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vps52 A G 17: 33,961,221 T300A probably benign Het
Wt1 A T 2: 105,127,284 H163L probably damaging Het
Xirp2 T C 2: 67,514,035 S2207P probably benign Het
Xpo6 A T 7: 126,107,078 I30N probably damaging Het
Zfp386 T A 12: 116,059,727 I320K probably benign Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103223050 missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103155808 missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103201352 missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103194621 missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103126753 missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103291283 splice site probably benign
IGL00960:Mycbp2 APN 14 103229384 missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103172642 missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103122547 missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103155510 missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103229492 splice site probably null
IGL01586:Mycbp2 APN 14 103140869 critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103291287 critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103127979 missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103135204 nonsense probably null
IGL01820:Mycbp2 APN 14 103188501 missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103143211 missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103154907 nonsense probably null
IGL02178:Mycbp2 APN 14 103224366 missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103242207 missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103314375 missense probably benign
IGL02607:Mycbp2 APN 14 103285273 missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103205185 missense probably benign
IGL02702:Mycbp2 APN 14 103220124 missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103155261 missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103114242 splice site probably benign
IGL02866:Mycbp2 APN 14 103129992 missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103177279 missense probably benign
IGL03082:Mycbp2 APN 14 103204369 missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103298776 missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103155453 missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103298698 missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103188589 missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103247758 missense probably damaging 1.00
decompose UTSW 14 103219979 missense probably benign 0.12
moulder UTSW 14 103188592 missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103224462 splice site probably benign
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103152142 missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103156634 unclassified probably benign
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103314325 nonsense probably null
R0388:Mycbp2 UTSW 14 103156667 missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103135133 missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103182459 missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103196391 unclassified probably benign
R0671:Mycbp2 UTSW 14 103194588 missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103174794 missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103220013 missense probably benign
R0903:Mycbp2 UTSW 14 103275857 missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103262693 unclassified probably benign
R0961:Mycbp2 UTSW 14 103184835 missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103140917 missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103174826 missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103200152 nonsense probably null
R1211:Mycbp2 UTSW 14 103120563 missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103208782 missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103155898 missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103298867 splice site probably benign
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103204389 missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103232597 missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103169851 splice site probably null
R1565:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103247758 missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103227511 missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103224416 missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103182419 missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103155714 missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103184883 missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103229404 missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103145971 missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103248403 missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103188592 missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103260239 missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103232524 critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103287260 missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103220076 missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103201230 missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103145942 missense probably benign
R2135:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2146:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103169855 critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103169859 missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103262749 missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103144338 missense probably null 0.66
R2379:Mycbp2 UTSW 14 103174950 missense probably benign
R2495:Mycbp2 UTSW 14 103200118 missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103131245 missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103155255 missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103297358 missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103208743 splice site probably benign
R3404:Mycbp2 UTSW 14 103200114 missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103135117 missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103229430 missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103156414 missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103133788 missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103197285 missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103174797 missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103126713 missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103204500 missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103295252 missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103138725 splice site probably benign
R4021:Mycbp2 UTSW 14 103152157 missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103248457 missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103123445 missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103287228 missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103135266 missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103133789 missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103188502 missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103155658 missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103346297 missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103177313 missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103188591 missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103219944 missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103229437 missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103211295 missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103145946 missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103287239 missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103260385 intron probably null
R4994:Mycbp2 UTSW 14 103169994 missense probably benign
R5029:Mycbp2 UTSW 14 103156510 missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103296939 missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103139235 critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103346214 critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103346321 missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103185683 critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103242432 nonsense probably null
R5414:Mycbp2 UTSW 14 103306261 missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103201401 missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103200126 missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103242179 missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103173814 missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103295237 missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103282645 nonsense probably null
R5569:Mycbp2 UTSW 14 103135243 missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103142767 missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103291333 missense probably damaging 0.98
R5592:Mycbp2 UTSW 14 103194677 missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188608 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188615 critical splice acceptor site probably null
R5646:Mycbp2 UTSW 14 103169910 missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103291342 missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103282665 missense probably null 0.99
R5668:Mycbp2 UTSW 14 103120519 missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103156453 missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103148550 missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103133974 missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103124403 missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103126684 missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103156723 missense probably benign
R6063:Mycbp2 UTSW 14 103135146 missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103223046 missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103275887 missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103285400 missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103155509 nonsense probably null
R6161:Mycbp2 UTSW 14 103298747 missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103147017 missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103295228 missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103260229 missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103155426 missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103262740 missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103155852 missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103155475 missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103136557 critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103142881 missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103191567 missense probably null 1.00
R6821:Mycbp2 UTSW 14 103139409 missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103260194 critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103285267 missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103154906 missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103206681 missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103174981 missense probably benign
R7054:Mycbp2 UTSW 14 103156098 missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103122603 missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103154077 missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103282679 missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103260200 missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103133846 missense probably benign
R7234:Mycbp2 UTSW 14 103215337 missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103156297 missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103208909 missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103197243 critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103120591 missense probably damaging 1.00
X0024:Mycbp2 UTSW 14 103146942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTCAGCAGACACTAACGAG -3'
(R):5'- TAATATAGTTGGTCTAACCCTGAGG -3'

Sequencing Primer
(F):5'- TCAGCAGACACTAACGAGTACATAGG -3'
(R):5'- AATCACTCTAAGACTGCTGCAATTC -3'
Posted On2016-10-26