Incidental Mutation 'R5591:Olfr347'
ID437504
Institutional Source Beutler Lab
Gene Symbol Olfr347
Ensembl Gene ENSMUSG00000111863
Gene Nameolfactory receptor 347
SynonymsGA_x6K02T2NLDC-33428755-33429693, MOR136-9
MMRRC Submission 043269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5591 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36731902-36737640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36735232 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 304 (I304F)
Ref Sequence ENSEMBL: ENSMUSP00000151158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078761] [ENSMUST00000216882]
Predicted Effect probably benign
Transcript: ENSMUST00000078761
AA Change: I304F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077819
Gene: ENSMUSG00000111863
AA Change: I304F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-5 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216882
AA Change: I304F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1784 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T C 7: 45,144,652 E13G probably null Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Bub1 A T 2: 127,819,343 M276K probably benign Het
Casp14 A T 10: 78,714,345 D156E unknown Het
Ccdc82 T A 9: 13,272,503 probably null Het
Cdc42bpb T C 12: 111,323,087 N436S probably benign Het
Cyp2j12 A G 4: 96,141,122 probably benign Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Daxx T C 17: 33,911,688 S226P probably damaging Het
Gm13101 G T 4: 143,964,960 L398I probably damaging Het
Gm3676 T C 14: 41,643,224 Y158C probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gnai1 A T 5: 18,271,846 I285K probably benign Het
Gpr179 C T 11: 97,345,755 V417I probably benign Het
Helz2 C T 2: 181,240,258 M247I probably damaging Het
Hmcn2 C T 2: 31,344,047 L275F probably damaging Het
Ifi27l2b A G 12: 103,451,307 V207A probably damaging Het
Isg20l2 C T 3: 87,930,424 probably benign Het
Itga6 A G 2: 71,840,590 D221G probably damaging Het
Lca5l T C 16: 96,178,729 Y67C probably damaging Het
Loxl3 T A 6: 83,048,037 C249S probably damaging Het
Luc7l3 T C 11: 94,293,234 probably benign Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mbd5 A C 2: 49,274,669 Q958H probably damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpp6 A G 6: 50,180,179 S276G probably benign Het
Mrm3 G A 11: 76,250,081 R305H probably benign Het
Olfr1261 A G 2: 89,993,407 T5A possibly damaging Het
Olfr1328 A T 4: 118,934,461 I127K probably damaging Het
Olfr170 T A 16: 19,605,858 Q270L probably damaging Het
Olfr320 A G 11: 58,684,125 N84S probably benign Het
Olfr635 G T 7: 103,980,113 R307L probably benign Het
Olfr709-ps1 A T 7: 106,927,282 M59K probably damaging Het
P3h3 C T 6: 124,854,695 probably benign Het
Plekhg3 C T 12: 76,560,292 S42L possibly damaging Het
Polq A G 16: 37,011,885 probably benign Het
Pramef25 T C 4: 143,948,807 Y483C probably damaging Het
Raph1 G A 1: 60,501,746 probably benign Het
Rnf144b G A 13: 47,242,954 probably null Het
Ryr2 A G 13: 11,595,014 S4309P probably benign Het
Sash1 A T 10: 8,725,718 S1158T probably benign Het
Sim2 T C 16: 94,097,189 V94A probably damaging Het
Sirt5 A G 13: 43,371,841 D42G possibly damaging Het
Skiv2l2 A T 13: 112,927,356 M1K probably null Het
Smarcal1 A T 1: 72,591,253 K155N probably damaging Het
Spam1 A G 6: 24,800,546 Y428C probably damaging Het
Spef2 T C 15: 9,583,836 N1655S probably benign Het
Sympk A G 7: 19,054,039 E1160G probably damaging Het
Tmem192 A G 8: 64,965,602 Y168C possibly damaging Het
Ttn T A 2: 76,709,668 M25998L probably benign Het
Usp48 A G 4: 137,652,652 probably benign Het
Vamp4 A G 1: 162,588,242 I71V possibly damaging Het
Washc5 C A 15: 59,369,163 D108Y probably damaging Het
Wdfy4 T A 14: 33,107,130 H1043L probably benign Het
Zcchc14 C T 8: 121,605,448 probably benign Het
Zfp407 A G 18: 84,561,137 F617S probably damaging Het
Zfp869 T A 8: 69,707,692 N77I probably benign Het
Other mutations in Olfr347
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02190:Olfr347 APN 2 36734579 missense probably benign 0.03
IGL02417:Olfr347 APN 2 36734344 missense probably benign 0.13
IGL02488:Olfr347 APN 2 36734350 missense probably benign 0.36
IGL02878:Olfr347 APN 2 36734477 missense probably damaging 1.00
IGL03354:Olfr347 APN 2 36734512 missense possibly damaging 0.87
IGL03354:Olfr347 APN 2 36734513 missense possibly damaging 0.89
R0091:Olfr347 UTSW 2 36734905 missense probably damaging 1.00
R0107:Olfr347 UTSW 2 36734718 nonsense probably null
R0457:Olfr347 UTSW 2 36734533 missense probably benign 0.18
R0563:Olfr347 UTSW 2 36735001 nonsense probably null
R1205:Olfr347 UTSW 2 36734755 missense probably benign 0.16
R1599:Olfr347 UTSW 2 36734989 missense probably benign 0.01
R1668:Olfr347 UTSW 2 36735192 nonsense probably null
R1845:Olfr347 UTSW 2 36734842 missense probably damaging 0.99
R1856:Olfr347 UTSW 2 36734345 missense probably benign
R2165:Olfr347 UTSW 2 36734701 missense probably damaging 0.97
R4399:Olfr347 UTSW 2 36735230 missense probably benign 0.00
R4657:Olfr347 UTSW 2 36734403 nonsense probably null
R4684:Olfr347 UTSW 2 36734674 missense probably damaging 1.00
R4767:Olfr347 UTSW 2 36734323 start codon destroyed probably benign 0.02
R4988:Olfr347 UTSW 2 36734984 missense possibly damaging 0.94
R5058:Olfr347 UTSW 2 36734999 missense possibly damaging 0.52
R5103:Olfr347 UTSW 2 36734668 missense probably benign 0.23
R5140:Olfr347 UTSW 2 36734498 missense possibly damaging 0.59
R5587:Olfr347 UTSW 2 36734621 missense probably damaging 1.00
R6738:Olfr347 UTSW 2 36734432 missense probably benign 0.26
R7097:Olfr347 UTSW 2 36734424 missense not run
R7122:Olfr347 UTSW 2 36734424 missense not run
Predicted Primers PCR Primer
(F):5'- GCAAAGCCTTGTCCACATGTG -3'
(R):5'- TAGGAAATCCTATCAAGATGCTGAAGC -3'

Sequencing Primer
(F):5'- GGCTCTCACCTCTGTGTGG -3'
(R):5'- CTGTGCAAGGATAACTGAGT -3'
Posted On2016-10-26