Incidental Mutation 'R5593:Wdtc1'
ID437615
Institutional Source Beutler Lab
Gene Symbol Wdtc1
Ensembl Gene ENSMUSG00000037622
Gene NameWD and tetratricopeptide repeats 1
Synonymsadipose, LOC230796, adp
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5593 (G1)
Quality Score183
Status Validated
Chromosome4
Chromosomal Location133292459-133353481 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 133294391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043305] [ENSMUST00000043305] [ENSMUST00000105906] [ENSMUST00000105906]
Predicted Effect probably null
Transcript: ENSMUST00000043305
SMART Domains Protein: ENSMUSP00000040647
Gene: ENSMUSG00000037622

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Pfam:TPR_11 362 429 1.1e-15 PFAM
Pfam:TPR_2 432 457 1.1e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
WD40 523 566 7.16e-1 SMART
WD40 569 608 1.55e-5 SMART
low complexity region 655 670 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000043305
SMART Domains Protein: ENSMUSP00000040647
Gene: ENSMUSG00000037622

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Pfam:TPR_11 362 429 1.1e-15 PFAM
Pfam:TPR_2 432 457 1.1e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
WD40 523 566 7.16e-1 SMART
WD40 569 608 1.55e-5 SMART
low complexity region 655 670 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105906
SMART Domains Protein: ENSMUSP00000101526
Gene: ENSMUSG00000037622

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Blast:WD40 261 296 5e-12 BLAST
Pfam:TPR_11 361 429 2.9e-16 PFAM
Pfam:TPR_2 432 457 1.4e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105906
SMART Domains Protein: ENSMUSP00000101526
Gene: ENSMUSG00000037622

DomainStartEndE-ValueType
WD40 36 75 4.58e-8 SMART
WD40 79 120 1.24e-4 SMART
WD40 123 163 2.58e-1 SMART
WD40 170 213 4.42e1 SMART
Blast:WD40 261 296 5e-12 BLAST
Pfam:TPR_11 361 429 2.9e-16 PFAM
Pfam:TPR_2 432 457 1.4e-3 PFAM
low complexity region 488 499 N/A INTRINSIC
Meta Mutation Damage Score 0.6472 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele are obese and insulin resistant with significantly elevated plasma insulin and leptin levels. Although a number of adult homozygotes are also described as obese, the majority of homozygotes die in utero thus precluding statistically significant analyses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Wdtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Wdtc1 APN 4 133295232 missense probably damaging 1.00
IGL02005:Wdtc1 APN 4 133308914 missense probably benign 0.14
IGL02078:Wdtc1 APN 4 133305960 missense probably damaging 1.00
IGL02146:Wdtc1 APN 4 133301765 missense probably benign 0.00
IGL02724:Wdtc1 APN 4 133297478 missense possibly damaging 0.78
IGL03196:Wdtc1 APN 4 133295337 missense probably damaging 1.00
pear UTSW 4 133294391 splice site probably null
R0448:Wdtc1 UTSW 4 133297500 missense probably damaging 1.00
R0501:Wdtc1 UTSW 4 133308840 missense possibly damaging 0.88
R0743:Wdtc1 UTSW 4 133300661 missense probably damaging 0.99
R1170:Wdtc1 UTSW 4 133297546 missense probably damaging 0.99
R1439:Wdtc1 UTSW 4 133301807 missense probably benign
R1456:Wdtc1 UTSW 4 133297428 missense possibly damaging 0.83
R1833:Wdtc1 UTSW 4 133308742 splice site probably benign
R4506:Wdtc1 UTSW 4 133308819 missense probably damaging 1.00
R4687:Wdtc1 UTSW 4 133296431 missense probably damaging 1.00
R4739:Wdtc1 UTSW 4 133301799 missense possibly damaging 0.68
R4967:Wdtc1 UTSW 4 133294343 missense probably damaging 0.99
R5032:Wdtc1 UTSW 4 133308851 missense possibly damaging 0.89
R5193:Wdtc1 UTSW 4 133294367 nonsense probably null
R5448:Wdtc1 UTSW 4 133294297 missense probably benign
R5890:Wdtc1 UTSW 4 133294362 missense unknown
R7536:Wdtc1 UTSW 4 133295250 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGAAAGCCAGCAAGTTGC -3'
(R):5'- GCTTGTATTCCTGCAGCCAC -3'

Sequencing Primer
(F):5'- GCAAGTTGCAGCAATCCC -3'
(R):5'- CTCCCCATGTGCCTAACCTTAGATAC -3'
Posted On2016-10-26