Incidental Mutation 'R5593:Cul1'
ID437622
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Namecullin 1
Synonyms
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47453398-47526139 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 47485086 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 196 (W196*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000143941] [ENSMUST00000146200] [ENSMUST00000146828] [ENSMUST00000152547]
Predicted Effect probably benign
Transcript: ENSMUST00000031697
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143941
SMART Domains Protein: ENSMUSP00000144845
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
PDB:1U6G|A 1 48 2e-26 PDB
SCOP:d1ldja2 17 47 3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146200
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146828
SMART Domains Protein: ENSMUSP00000121608
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
Pfam:Cullin 21 110 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152547
Predicted Effect probably null
Transcript: ENSMUST00000154391
AA Change: W196*
Meta Mutation Damage Score 0.6436 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47509044 missense probably benign
IGL02410:Cul1 APN 6 47485014 missense probably damaging 1.00
IGL02458:Cul1 APN 6 47525608 missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47514886 missense probably damaging 0.98
IGL03065:Cul1 APN 6 47495081 missense probably damaging 1.00
IGL03387:Cul1 APN 6 47501209 missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47523205 missense probably benign 0.01
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0436:Cul1 UTSW 6 47523773 missense probably benign 0.16
R0746:Cul1 UTSW 6 47518288 splice site probably null
R1103:Cul1 UTSW 6 47517177 missense probably benign 0.03
R1471:Cul1 UTSW 6 47514886 missense probably damaging 0.98
R1746:Cul1 UTSW 6 47508245 missense probably damaging 0.98
R1852:Cul1 UTSW 6 47520830 missense probably damaging 0.99
R1858:Cul1 UTSW 6 47525524 intron probably null
R1937:Cul1 UTSW 6 47508355 missense probably benign 0.19
R1964:Cul1 UTSW 6 47502571 missense probably damaging 0.98
R2985:Cul1 UTSW 6 47502507 missense probably damaging 1.00
R4452:Cul1 UTSW 6 47508989 nonsense probably null
R4653:Cul1 UTSW 6 47484963 missense probably damaging 1.00
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R5141:Cul1 UTSW 6 47520839 missense probably benign 0.04
R5328:Cul1 UTSW 6 47508317 missense probably damaging 0.99
R5399:Cul1 UTSW 6 47485084 unclassified probably null
R5593:Cul1 UTSW 6 47514991 missense probably damaging 0.99
R5616:Cul1 UTSW 6 47523788 missense probably damaging 1.00
R5855:Cul1 UTSW 6 47523213 missense probably benign 0.00
R6382:Cul1 UTSW 6 47502439 missense probably damaging 1.00
R6670:Cul1 UTSW 6 47517134 missense probably damaging 1.00
R6964:Cul1 UTSW 6 47516509 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGAGTCAGAATCCTCATGGAC -3'
(R):5'- GTAAATCATTACAGGACCTCCCAAGG -3'

Sequencing Primer
(F):5'- TCCTCATGGACTGAAGCAGATTG -3'
(R):5'- TGAGACCCACAATGTGATGTC -3'
Posted On2016-10-26