Incidental Mutation 'R5593:Slc25a19'
ID437644
Institutional Source Beutler Lab
Gene Symbol Slc25a19
Ensembl Gene ENSMUSG00000020744
Gene Namesolute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19
Synonyms2900089E13Rik, DNC, MUP1, TPC
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115614178-115628295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115616592 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 235 (Y235N)
Ref Sequence ENSEMBL: ENSMUSP00000137534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021087] [ENSMUST00000021089] [ENSMUST00000106503] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000135552] [ENSMUST00000148574] [ENSMUST00000178003]
Predicted Effect probably benign
Transcript: ENSMUST00000021087
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021089
AA Change: Y235N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021089
Gene: ENSMUSG00000020744
AA Change: Y235N

DomainStartEndE-ValueType
Pfam:Mito_carr 12 111 5.7e-20 PFAM
Pfam:Mito_carr 114 205 5.3e-24 PFAM
Pfam:Mito_carr 212 313 5.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106503
AA Change: H173Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102112
Gene: ENSMUSG00000020744
AA Change: H173Q

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.7e-22 PFAM
Pfam:Mito_carr 114 172 9.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106506
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129194
Predicted Effect possibly damaging
Transcript: ENSMUST00000135552
AA Change: Y152N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114566
Gene: ENSMUSG00000020744
AA Change: Y152N

DomainStartEndE-ValueType
Pfam:Mito_carr 31 122 1.1e-25 PFAM
Pfam:Mito_carr 129 226 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146244
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178003
AA Change: Y235N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137534
Gene: ENSMUSG00000020744
AA Change: Y235N

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.1e-21 PFAM
Pfam:Mito_carr 114 205 7e-25 PFAM
Pfam:Mito_carr 212 313 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180919
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is a member of the solute carrier family. Although this protein was initially thought to be the mitochondrial deoxynucleotide carrier involved in the uptake of deoxynucleotides into the matrix of the mitochondria, further studies have demonstrated that this protein instead functions as the mitochondrial thiamine pyrophosphate carrier, which transports thiamine pyrophosphates into mitochondria. Mutations in this gene cause microcephaly, Amish type, a metabolic disease that results in severe congenital microcephaly, severe 2-ketoglutaric aciduria, and death within the first year. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality by E12, neural tube closure defects resulting in exencephaly and microcephaly, growth arrest, anemia, elevated alpha-ketoglutarate in amniotic fluid, and reduced thiamine pyrophosphate content in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Slc25a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
Baggins UTSW 11 115617560 missense possibly damaging 0.91
PIT4498001:Slc25a19 UTSW 11 115623955 missense possibly damaging 0.80
R0335:Slc25a19 UTSW 11 115624206 missense probably damaging 1.00
R0398:Slc25a19 UTSW 11 115617575 missense probably damaging 1.00
R0454:Slc25a19 UTSW 11 115617597 nonsense probably null
R1614:Slc25a19 UTSW 11 115616623 nonsense probably null
R3775:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R3776:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R5000:Slc25a19 UTSW 11 115616671 intron probably null
R5738:Slc25a19 UTSW 11 115624234 missense probably benign 0.24
R6167:Slc25a19 UTSW 11 115615551 missense probably benign 0.14
R6306:Slc25a19 UTSW 11 115617560 missense possibly damaging 0.91
R7014:Slc25a19 UTSW 11 115620966 missense probably damaging 1.00
R7161:Slc25a19 UTSW 11 115616547 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCAGGTGTGTTTATGCACA -3'
(R):5'- CACAGTGATGTGCTGGCTAA -3'

Sequencing Primer
(F):5'- GTGTTTATGCACAGAAATAAAGCTAC -3'
(R):5'- CAAGCAATTGTGAGCTGTCTGAC -3'
Posted On2016-10-26