Incidental Mutation 'R5593:Nrcam'
ID437646
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Nameneuronal cell adhesion molecule
SynonymsC030017F07Rik, Bravo, C130076O07Rik
MMRRC Submission 043145-MU
Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location44328885-44601964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44559700 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 410 (T410A)
Ref Sequence ENSEMBL: ENSMUSP00000106376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000220123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020939
AA Change: T410A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: T410A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110748
AA Change: T410A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: T410A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219906
Predicted Effect possibly damaging
Transcript: ENSMUST00000220123
AA Change: T416A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220130
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mefv A T 16: 3,715,451 C319S probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44575884 missense probably benign 0.27
IGL01657:Nrcam APN 12 44559800 missense probably damaging 1.00
IGL02434:Nrcam APN 12 44590243 splice site probably benign
IGL02455:Nrcam APN 12 44570530 missense probably damaging 1.00
IGL02712:Nrcam APN 12 44573827 missense probably damaging 1.00
IGL02834:Nrcam APN 12 44541075 critical splice donor site probably null
IGL03022:Nrcam APN 12 44598442 missense probably damaging 1.00
IGL03174:Nrcam APN 12 44576006 splice site probably benign
IGL03389:Nrcam APN 12 44549906 missense probably benign 0.00
IGL03397:Nrcam APN 12 44559757 missense probably damaging 1.00
I2288:Nrcam UTSW 12 44564315 missense probably benign 0.06
I2289:Nrcam UTSW 12 44564315 missense probably benign 0.06
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44584845 missense probably benign 0.00
R0463:Nrcam UTSW 12 44551341 missense probably damaging 1.00
R0590:Nrcam UTSW 12 44564032 missense probably damaging 1.00
R0674:Nrcam UTSW 12 44564322 missense probably benign 0.17
R0930:Nrcam UTSW 12 44549884 missense probably benign
R1241:Nrcam UTSW 12 44590164 missense probably damaging 1.00
R1279:Nrcam UTSW 12 44544877 unclassified probably null
R1523:Nrcam UTSW 12 44572249 missense probably damaging 1.00
R1572:Nrcam UTSW 12 44537364 splice site probably benign
R1629:Nrcam UTSW 12 44563986 missense probably benign 0.00
R1651:Nrcam UTSW 12 44576679 missense probably damaging 0.97
R1729:Nrcam UTSW 12 44573850 missense probably benign
R1739:Nrcam UTSW 12 44571675 missense probably damaging 1.00
R1803:Nrcam UTSW 12 44572208 missense probably benign
R1884:Nrcam UTSW 12 44544755 missense probably damaging 1.00
R1974:Nrcam UTSW 12 44563993 missense probably benign 0.05
R1992:Nrcam UTSW 12 44540970 missense probably damaging 1.00
R2102:Nrcam UTSW 12 44576688 missense probably benign 0.00
R2106:Nrcam UTSW 12 44570290 missense probably benign 0.12
R3854:Nrcam UTSW 12 44575884 missense probably benign 0.27
R4005:Nrcam UTSW 12 44532646 missense probably benign
R4088:Nrcam UTSW 12 44572202 missense possibly damaging 0.93
R4115:Nrcam UTSW 12 44566326 missense possibly damaging 0.87
R4428:Nrcam UTSW 12 44576775 missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44559730 missense probably damaging 1.00
R4580:Nrcam UTSW 12 44562540 critical splice donor site probably null
R4601:Nrcam UTSW 12 44591056 missense probably damaging 1.00
R4688:Nrcam UTSW 12 44547237 missense probably benign
R4825:Nrcam UTSW 12 44575986 nonsense probably null
R4838:Nrcam UTSW 12 44574019 missense probably damaging 1.00
R4950:Nrcam UTSW 12 44598490 missense probably damaging 1.00
R4960:Nrcam UTSW 12 44566299 missense probably benign 0.01
R5081:Nrcam UTSW 12 44570353 missense probably benign 0.00
R5297:Nrcam UTSW 12 44544784 missense probably damaging 1.00
R5504:Nrcam UTSW 12 44564132 critical splice donor site probably null
R5654:Nrcam UTSW 12 44564058 missense probably benign
R5691:Nrcam UTSW 12 44564256 missense probably damaging 1.00
R5890:Nrcam UTSW 12 44576771 missense probably benign
R5937:Nrcam UTSW 12 44572291 missense probably benign 0.00
R5980:Nrcam UTSW 12 44571633 missense probably damaging 1.00
R6132:Nrcam UTSW 12 44570224 missense probably damaging 1.00
R6213:Nrcam UTSW 12 44562432 missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44572300 missense probably benign
R6617:Nrcam UTSW 12 44540963 missense probably damaging 1.00
R6666:Nrcam UTSW 12 44571555 missense probably damaging 1.00
R7191:Nrcam UTSW 12 44572244 missense probably benign 0.01
R7284:Nrcam UTSW 12 44564034 missense probably damaging 1.00
R7326:Nrcam UTSW 12 44564026 missense possibly damaging 0.95
R7388:Nrcam UTSW 12 44598489 missense probably damaging 1.00
U24488:Nrcam UTSW 12 44537259 missense probably damaging 1.00
X0057:Nrcam UTSW 12 44551416 missense probably benign
X0066:Nrcam UTSW 12 44550029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGATGCATCTACTTAGACCAG -3'
(R):5'- TCTTTGTAGCTTCAAACACTGTGC -3'

Sequencing Primer
(F):5'- AGACCAGCCTGTATTTACTTCCCAG -3'
(R):5'- GTAGCTTCAAACACTGTGCATTAC -3'
Posted On2016-10-26