Incidental Mutation 'R5593:Mefv'
ID437659
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene NameMediterranean fever
SynonymsTRIM20, marenostrin, pyrin, FMF
MMRRC Submission 043145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5593 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3707218-3718097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3715451 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 319 (C319S)
Ref Sequence ENSEMBL: ENSMUSP00000154892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
Predicted Effect probably benign
Transcript: ENSMUST00000023180
AA Change: C319S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534
AA Change: C319S

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100222
AA Change: C319S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534
AA Change: C319S

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229725
AA Change: C319S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
9330182L06Rik T A 5: 9,266,350 L27Q probably benign Het
Anpep T G 7: 79,842,046 K69T probably benign Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
Copb2 A G 9: 98,587,038 probably null Het
Cpa5 T C 6: 30,630,849 I370T probably benign Het
Cpn2 T C 16: 30,260,080 T268A probably benign Het
Ctbp2 C A 7: 132,998,869 R99I possibly damaging Het
Cul1 G A 6: 47,485,086 W196* probably null Het
Cul1 T C 6: 47,514,991 F402L probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dyrk1a C A 16: 94,659,583 Q33K possibly damaging Het
Epg5 T A 18: 77,957,474 S542T probably damaging Het
Eps8l3 A T 3: 107,891,188 probably benign Het
Evc2 A G 5: 37,386,977 H690R probably damaging Het
Fam227a G A 15: 79,640,058 probably benign Het
Gadl1 G T 9: 116,006,650 G382V probably damaging Het
Gbf1 A G 19: 46,272,524 Q1176R possibly damaging Het
Gdf9 A T 11: 53,433,731 H109L probably damaging Het
Gm7534 T C 4: 134,193,039 K605R probably damaging Het
Gsdmd T A 15: 75,867,007 V411D probably damaging Het
Hdc T C 2: 126,618,584 probably benign Het
Ifrd2 A G 9: 107,590,175 D82G probably damaging Het
Itpkb T C 1: 180,334,096 S596P probably damaging Het
Kcnmb3 A G 3: 32,491,947 V8A possibly damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Mcm9 G A 10: 53,538,297 T229I probably damaging Het
Medag T A 5: 149,426,950 F21L probably benign Het
Mettl23 T A 11: 116,843,767 V54D probably damaging Het
Mul1 A G 4: 138,439,232 D199G probably damaging Het
Ncor1 A T 11: 62,369,304 I266N probably damaging Het
Nek10 A T 14: 14,980,544 K967* probably null Het
Nrcam A G 12: 44,559,700 T410A probably damaging Het
Olfr222 T C 11: 59,571,048 R231G possibly damaging Het
Olfr59 A G 11: 74,288,792 I49V possibly damaging Het
Olfr607 C T 7: 103,460,385 silent Het
Olfr677 T C 7: 105,056,504 I86T probably damaging Het
Pate2 A T 9: 35,670,482 D24V possibly damaging Het
Plcb3 T C 19: 6,954,749 I1124V possibly damaging Het
Ptprc A T 1: 138,117,720 probably benign Het
Rab6a T C 7: 100,608,171 probably benign Het
Rnf208 G T 2: 25,243,333 W13L possibly damaging Het
Rps6kl1 G T 12: 85,146,901 Q139K possibly damaging Het
Sdk1 T A 5: 141,956,124 I509N probably damaging Het
Sephs1 A G 2: 4,893,287 I170V probably benign Het
Slc17a8 C T 10: 89,606,840 D44N probably benign Het
Slc23a1 T A 18: 35,622,296 I489F probably damaging Het
Slc25a19 A T 11: 115,616,592 Y235N probably damaging Het
Slc47a2 A G 11: 61,342,660 V40A probably benign Het
Slurp2 C T 15: 74,743,068 V75I probably benign Het
Smc1b A C 15: 85,121,641 M354R probably benign Het
Spice1 C A 16: 44,370,752 A323E possibly damaging Het
Sptbn2 T A 19: 4,748,947 V2015E probably damaging Het
Sptlc2 A C 12: 87,369,083 F57V probably benign Het
Srsf1 A G 11: 88,047,879 N14S possibly damaging Het
Ssh2 T A 11: 77,421,366 D228E probably damaging Het
Synj2 A G 17: 6,038,115 *1480W probably null Het
Syt14 A T 1: 192,930,923 M523K probably damaging Het
Tff3 A T 17: 31,129,542 V12E probably benign Het
Tgm2 C A 2: 158,127,342 C371F probably damaging Het
Tmem260 A C 14: 48,474,044 I197L probably benign Het
Unc5a A G 13: 55,004,934 D887G possibly damaging Het
Vstm4 G T 14: 32,919,290 A277S probably benign Het
Wdtc1 A T 4: 133,294,391 probably null Het
Zan A G 5: 137,468,338 F419S possibly damaging Het
Zfp317 G A 9: 19,647,288 R266Q probably damaging Het
Zfp931 T A 2: 178,067,802 T264S possibly damaging Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3710960 missense probably benign 0.01
IGL00583:Mefv APN 16 3716072 nonsense probably null
IGL00963:Mefv APN 16 3715720 missense possibly damaging 0.83
IGL02185:Mefv APN 16 3715850 missense probably benign 0.09
IGL02500:Mefv APN 16 3713577 missense probably damaging 1.00
R0158:Mefv UTSW 16 3715456 missense possibly damaging 0.67
R1312:Mefv UTSW 16 3708534 splice site probably benign
R1793:Mefv UTSW 16 3708664 missense possibly damaging 0.53
R1956:Mefv UTSW 16 3717827 missense probably damaging 1.00
R2169:Mefv UTSW 16 3710888 missense probably benign 0.24
R2973:Mefv UTSW 16 3715694 nonsense probably null
R3723:Mefv UTSW 16 3708194 critical splice donor site probably null
R3724:Mefv UTSW 16 3708194 critical splice donor site probably null
R3953:Mefv UTSW 16 3715400 missense possibly damaging 0.60
R4276:Mefv UTSW 16 3715569 missense probably benign 0.41
R4650:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4651:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4652:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4670:Mefv UTSW 16 3708207 missense possibly damaging 0.67
R4781:Mefv UTSW 16 3715334 missense probably benign 0.00
R5834:Mefv UTSW 16 3716046 missense probably damaging 0.97
R5867:Mefv UTSW 16 3715933 missense probably damaging 1.00
R5954:Mefv UTSW 16 3715715 missense probably benign 0.09
R6056:Mefv UTSW 16 3708042 missense possibly damaging 0.73
R6260:Mefv UTSW 16 3713034 missense probably benign 0.03
R6409:Mefv UTSW 16 3710793 critical splice donor site probably null
R6511:Mefv UTSW 16 3715946 missense probably benign 0.00
R6666:Mefv UTSW 16 3707998 missense possibly damaging 0.88
R6952:Mefv UTSW 16 3710880 missense probably damaging 1.00
R7259:Mefv UTSW 16 3713053 missense probably damaging 1.00
R7410:Mefv UTSW 16 3715681 missense probably damaging 1.00
R7444:Mefv UTSW 16 3715522 missense probably benign 0.21
X0064:Mefv UTSW 16 3710841 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGGGCCTGCATCACATTTTC -3'
(R):5'- TTCAGAAGTTCTTCCAACTCAAGAG -3'

Sequencing Primer
(F):5'- CACATTTTCTTGAGACCTGAAGGAG -3'
(R):5'- GTTCTTCCAACTCAAGAGGAAAC -3'
Posted On2016-10-26