Incidental Mutation 'R5594:Cr2'
ID437675
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 043146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R5594 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 195157190 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 643 (I643T)
Ref Sequence ENSEMBL: ENSMUSP00000141538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: I643T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: I643T

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192604
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: I346T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: I346T

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: I643T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: I643T

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195737
Predicted Effect unknown
Transcript: ENSMUST00000210219
AA Change: I1019T
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
4931414P19Rik A G 14: 54,584,984 Y399H probably damaging Het
5430419D17Rik T A 7: 131,239,523 D647E probably benign Het
6430573F11Rik A G 8: 36,512,298 T352A probably benign Het
Abca9 G T 11: 110,144,862 P644Q probably damaging Het
Acly T C 11: 100,522,120 probably null Het
Adamts14 A T 10: 61,227,101 probably null Het
Ankdd1a T C 9: 65,502,241 N471S probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgef28 T C 13: 97,939,492 T1345A probably benign Het
Arhgef40 T A 14: 51,996,157 L820H probably damaging Het
Atp2b4 A G 1: 133,730,510 V554A probably damaging Het
Birc7 G A 2: 180,933,336 probably null Het
Ccdc80 C T 16: 45,116,263 R684C probably benign Het
Cdc25b C A 2: 131,191,618 P159Q probably damaging Het
Chek2 G T 5: 110,855,834 probably null Het
Chil6 C T 3: 106,394,429 probably null Het
Cwf19l2 C A 9: 3,418,773 Q187K probably benign Het
Cyth4 A G 15: 78,607,075 probably null Het
Depdc5 A G 5: 32,901,490 T268A possibly damaging Het
Dnah17 G T 11: 118,043,229 probably null Het
Dnah3 T C 7: 119,971,621 Y2210C possibly damaging Het
Elmod3 G A 6: 72,594,816 probably benign Het
Eogt T A 6: 97,116,035 T394S probably benign Het
Evi5 A G 5: 107,820,451 V182A possibly damaging Het
Fbxo30 T C 10: 11,290,479 I315T probably benign Het
Fibcd1 T C 2: 31,838,617 N76S probably damaging Het
Gcc2 G T 10: 58,287,242 R1190M probably damaging Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Gm11543 T A 11: 94,828,554 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hhip G T 8: 79,996,863 D387E probably damaging Het
Hif1a T A 12: 73,937,792 Y46* probably null Het
Hivep3 G T 4: 120,123,048 probably null Het
Kif13a T A 13: 46,752,862 E535V probably damaging Het
Lrch3 T C 16: 32,914,184 Y15H probably damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Lyst T A 13: 13,759,397 V3560E probably benign Het
Megf11 T C 9: 64,686,473 F613L probably damaging Het
Misp G A 10: 79,827,143 V465M probably damaging Het
Ms4a6c T A 19: 11,478,173 D115E probably benign Het
Msh6 A G 17: 87,986,069 T751A probably benign Het
Ntrk3 T A 7: 78,451,899 T429S probably benign Het
Olfr128 T A 17: 37,923,611 M15K probably benign Het
Olfr857 T C 9: 19,713,006 Y60H probably damaging Het
Oplah A C 15: 76,296,637 *1289G probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhga6 A T 18: 37,708,528 T434S probably benign Het
Pign A G 1: 105,646,869 probably benign Het
Poteg A T 8: 27,447,968 I51F probably benign Het
Prrc2c C A 1: 162,699,031 V204F unknown Het
Rhbdd3 T C 11: 5,105,710 S325P probably damaging Het
Rit1 T A 3: 88,729,137 L116Q probably damaging Het
Rpl22 T A 4: 152,325,802 probably benign Het
Rttn A G 18: 89,090,436 E1588G possibly damaging Het
Sardh A G 2: 27,220,723 F577S probably damaging Het
Slc12a7 T A 13: 73,785,139 D105E probably benign Het
Slc22a23 T A 13: 34,305,257 D215V probably damaging Het
Slc4a8 C A 15: 100,795,887 P438T probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Stk19 C T 17: 34,820,562 probably benign Het
Stx5a T C 19: 8,748,465 I143T probably damaging Het
Tep1 T C 14: 50,829,882 H2232R possibly damaging Het
Ttc21b A G 2: 66,236,235 I358T probably benign Het
Tuba8 A G 6: 121,225,904 D392G possibly damaging Het
Vmn1r1 G A 1: 182,157,407 P231L probably damaging Het
Zfp330 A G 8: 82,767,312 W107R probably damaging Het
Zfp715 T A 7: 43,299,692 Q281H possibly damaging Het
Zfp9 T C 6: 118,465,039 T221A probably damaging Het
Zgpat T C 2: 181,365,627 probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGACTAGTTTGTGCAAGGCAC -3'
(R):5'- AACTCATCGGGGAGCAAACC -3'

Sequencing Primer
(F):5'- TGCAAGGCACCAAATTTTATCTCCAG -3'
(R):5'- GGGGAGCAAACCATCCACTG -3'
Posted On2016-10-26