Mutagenetix > Incidental Mutation

Incidental Mutation 'R5594:Chek2'

437689

Institutional Source

Beutler Lab

Gene Symbol

Chek2

Ensembl Gene

ENSMUSG00000029521

Gene Name

checkpoint kinase 2

Synonyms

CHK2, Rad53

MMRRC Submission

043146-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110987845-111022011 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 111003700 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000066679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]

AlphaFold

Q9Z265

Predicted Effect

probably null
Transcript: ENSMUST00000066160

SMART Domains

Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
low complexity region	41	72	N/A	INTRINSIC
FHA	116	179	5.14e-3	SMART
S_TKc	224	490	7.35e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199937

SMART Domains

Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
low complexity region	41	72	N/A	INTRINSIC
FHA	116	179	2.6e-5	SMART

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	C	T	11: 3,888,027 (GRCm39)	V120I	unknown	Het
4931414P19Rik	A	G	14: 54,822,441 (GRCm39)	Y399H	probably damaging	Het
Abca9	G	T	11: 110,035,688 (GRCm39)	P644Q	probably damaging	Het
Acly	T	C	11: 100,412,946 (GRCm39)		probably null	Het
Adamts14	A	T	10: 61,062,880 (GRCm39)		probably null	Het
Ankdd1a	T	C	9: 65,409,523 (GRCm39)	N471S	probably damaging	Het
Ankrd39	C	T	1: 36,581,062 (GRCm39)	G96R	probably damaging	Het
Arhgef28	T	C	13: 98,076,000 (GRCm39)	T1345A	probably benign	Het
Arhgef40	T	A	14: 52,233,614 (GRCm39)	L820H	probably damaging	Het
Atp2b4	A	G	1: 133,658,248 (GRCm39)	V554A	probably damaging	Het
Birc7	G	A	2: 180,575,129 (GRCm39)		probably null	Het
Ccdc80	C	T	16: 44,936,626 (GRCm39)	R684C	probably benign	Het
Cdc25b	C	A	2: 131,033,538 (GRCm39)	P159Q	probably damaging	Het
Cdcp3	T	A	7: 130,841,252 (GRCm39)	D647E	probably benign	Het
Chil6	C	T	3: 106,301,745 (GRCm39)		probably null	Het
Cr2	A	G	1: 194,839,498 (GRCm39)	I643T	probably damaging	Het
Cwf19l2	C	A	9: 3,418,773 (GRCm39)	Q187K	probably benign	Het
Cyth4	A	G	15: 78,491,275 (GRCm39)		probably null	Het
Depdc5	A	G	5: 33,058,834 (GRCm39)	T268A	possibly damaging	Het
Dnah17	G	T	11: 117,934,055 (GRCm39)		probably null	Het
Dnah3	T	C	7: 119,570,844 (GRCm39)	Y2210C	possibly damaging	Het
Elmod3	G	A	6: 72,571,799 (GRCm39)		probably benign	Het
Eogt	T	A	6: 97,092,996 (GRCm39)	T394S	probably benign	Het
Evi5	A	G	5: 107,968,317 (GRCm39)	V182A	possibly damaging	Het
Fbxo30	T	C	10: 11,166,223 (GRCm39)	I315T	probably benign	Het
Fibcd1	T	C	2: 31,728,629 (GRCm39)	N76S	probably damaging	Het
Gcc2	G	T	10: 58,123,064 (GRCm39)	R1190M	probably damaging	Het
Gfm2	T	C	13: 97,301,546 (GRCm39)	S450P	probably damaging	Het
Glg1	G	A	8: 111,914,513 (GRCm39)	R424C	probably damaging	Het
Gm11543	T	A	11: 94,719,380 (GRCm39)		noncoding transcript	Het
Hhip	G	T	8: 80,723,492 (GRCm39)	D387E	probably damaging	Het
Hif1a	T	A	12: 73,984,566 (GRCm39)	Y46*	probably null	Het
Hivep3	G	T	4: 119,980,245 (GRCm39)		probably null	Het
Kif13a	T	A	13: 46,906,338 (GRCm39)	E535V	probably damaging	Het
Lrch3	T	C	16: 32,734,554 (GRCm39)	Y15H	probably damaging	Het
Lyst	T	G	13: 13,917,918 (GRCm39)	I3326S	probably damaging	Het
Lyst	T	A	13: 13,933,982 (GRCm39)	V3560E	probably benign	Het
Megf11	T	C	9: 64,593,755 (GRCm39)	F613L	probably damaging	Het
Misp	G	A	10: 79,662,977 (GRCm39)	V465M	probably damaging	Het
Mplkipl1	C	T	19: 61,164,364 (GRCm39)	G24R	unknown	Het
Ms4a6c	T	A	19: 11,455,537 (GRCm39)	D115E	probably benign	Het
Msh6	A	G	17: 88,293,497 (GRCm39)	T751A	probably benign	Het
Ntrk3	T	A	7: 78,101,647 (GRCm39)	T429S	probably benign	Het
Oplah	A	C	15: 76,180,837 (GRCm39)	*1289G	probably null	Het
Or14j7	T	A	17: 38,234,502 (GRCm39)	M15K	probably benign	Het
Or7e166	T	C	9: 19,624,302 (GRCm39)	Y60H	probably damaging	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Pcdhga6	A	T	18: 37,841,581 (GRCm39)	T434S	probably benign	Het
Pign	A	G	1: 105,574,594 (GRCm39)		probably benign	Het
Poteg	A	T	8: 27,937,996 (GRCm39)	I51F	probably benign	Het
Prrc2c	C	A	1: 162,526,600 (GRCm39)	V204F	unknown	Het
Rhbdd3	T	C	11: 5,055,710 (GRCm39)	S325P	probably damaging	Het
Rit1	T	A	3: 88,636,444 (GRCm39)	L116Q	probably damaging	Het
Rpl22	T	A	4: 152,410,259 (GRCm39)		probably benign	Het
Rttn	A	G	18: 89,108,560 (GRCm39)	E1588G	possibly damaging	Het
Sardh	A	G	2: 27,110,735 (GRCm39)	F577S	probably damaging	Het
Slc12a7	T	A	13: 73,933,258 (GRCm39)	D105E	probably benign	Het
Slc22a23	T	A	13: 34,489,240 (GRCm39)	D215V	probably damaging	Het
Slc4a8	C	A	15: 100,693,768 (GRCm39)	P438T	probably damaging	Het
Sntb1	C	G	15: 55,506,191 (GRCm39)	G461R	probably damaging	Het
Stk19	C	T	17: 35,039,538 (GRCm39)		probably benign	Het
Stx5a	T	C	19: 8,725,829 (GRCm39)	I143T	probably damaging	Het
Tep1	T	C	14: 51,067,339 (GRCm39)	H2232R	possibly damaging	Het
Trmt9b	A	G	8: 36,979,452 (GRCm39)	T352A	probably benign	Het
Ttc21b	A	G	2: 66,066,579 (GRCm39)	I358T	probably benign	Het
Tuba8	A	G	6: 121,202,863 (GRCm39)	D392G	possibly damaging	Het
Vmn1r1	G	A	1: 181,984,972 (GRCm39)	P231L	probably damaging	Het
Zfp330	A	G	8: 83,493,941 (GRCm39)	W107R	probably damaging	Het
Zfp715	T	A	7: 42,949,116 (GRCm39)	Q281H	possibly damaging	Het
Zfp9	T	C	6: 118,442,000 (GRCm39)	T221A	probably damaging	Het
Zgpat	T	C	2: 181,007,420 (GRCm39)		probably benign	Het

Other mutations in Chek2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01025:Chek2	APN	5	110,996,536 (GRCm39)	missense	probably damaging	1.00
IGL01830:Chek2	APN	5	111,021,374 (GRCm39)	missense	probably benign
IGL01943:Chek2	APN	5	110,989,093 (GRCm39)	unclassified	probably benign
IGL02319:Chek2	APN	5	111,014,877 (GRCm39)	missense	possibly damaging	0.88
IGL03147:Chek2	UTSW	5	110,996,536 (GRCm39)	missense	probably damaging	1.00
PIT4520001:Chek2	UTSW	5	111,011,195 (GRCm39)	missense	probably damaging	1.00
R1484:Chek2	UTSW	5	110,996,553 (GRCm39)	missense	probably damaging	1.00
R1486:Chek2	UTSW	5	110,989,093 (GRCm39)	unclassified	probably benign
R1732:Chek2	UTSW	5	111,019,968 (GRCm39)	missense	probably benign	0.26
R2041:Chek2	UTSW	5	110,996,530 (GRCm39)	missense	probably damaging	1.00
R2071:Chek2	UTSW	5	110,989,112 (GRCm39)	unclassified	probably benign
R2873:Chek2	UTSW	5	111,011,202 (GRCm39)	nonsense	probably null
R2935:Chek2	UTSW	5	111,015,886 (GRCm39)	missense	probably damaging	1.00
R3899:Chek2	UTSW	5	111,013,479 (GRCm39)	splice site	probably benign
R4662:Chek2	UTSW	5	111,014,908 (GRCm39)	missense	probably damaging	1.00
R4748:Chek2	UTSW	5	111,003,705 (GRCm39)	splice site	probably null
R5358:Chek2	UTSW	5	110,989,148 (GRCm39)	unclassified	probably benign
R5582:Chek2	UTSW	5	111,015,901 (GRCm39)	missense	probably damaging	0.96
R6526:Chek2	UTSW	5	110,996,556 (GRCm39)	missense	probably damaging	1.00
R6972:Chek2	UTSW	5	111,003,705 (GRCm39)	splice site	probably null
R7232:Chek2	UTSW	5	111,008,781 (GRCm39)	missense	probably damaging	1.00
R7338:Chek2	UTSW	5	111,021,380 (GRCm39)	missense	probably benign
R7395:Chek2	UTSW	5	111,019,974 (GRCm39)	critical splice donor site	probably null
R7714:Chek2	UTSW	5	110,989,319 (GRCm39)	missense	probably benign	0.10
R7743:Chek2	UTSW	5	110,987,916 (GRCm39)	critical splice donor site	probably null
R8290:Chek2	UTSW	5	111,008,766 (GRCm39)	missense	possibly damaging	0.70
R8297:Chek2	UTSW	5	110,996,302 (GRCm39)	missense	probably damaging	1.00
R8719:Chek2	UTSW	5	111,014,908 (GRCm39)	missense	probably damaging	0.98
R8898:Chek2	UTSW	5	111,011,175 (GRCm39)	missense	probably benign	0.00
R8906:Chek2	UTSW	5	111,013,458 (GRCm39)	utr 3 prime	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCAAGGCCGAGTTTGACATG -3'
(R):5'- ACTATGCACAGGGTTACATACAAC -3'

Sequencing Primer
(F):5'- CAAGGCCGAGTTTGACATGGTATG -3'
(R):5'- TTGCTCCATCTAAGCCAC -3'

Posted On

2016-10-26