Incidental Mutation 'R5594:Rhbdd3'
ID437713
Institutional Source Beutler Lab
Gene Symbol Rhbdd3
Ensembl Gene ENSMUSG00000034175
Gene Namerhomboid domain containing 3
Synonyms
MMRRC Submission 043146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5594 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5098926-5106093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5105710 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 325 (S325P)
Ref Sequence ENSEMBL: ENSMUSP00000105504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036320] [ENSMUST00000062821] [ENSMUST00000101610] [ENSMUST00000109878] [ENSMUST00000134267] [ENSMUST00000139742] [ENSMUST00000148761] [ENSMUST00000150632] [ENSMUST00000163299]
Predicted Effect probably benign
Transcript: ENSMUST00000036320
AA Change: S315P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044703
Gene: ENSMUSG00000034175
AA Change: S315P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 185 2.2e-7 PFAM
SCOP:d1ifya_ 308 351 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062821
SMART Domains Protein: ENSMUSP00000061704
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 101 8.7e-18 PFAM
low complexity region 200 211 N/A INTRINSIC
low complexity region 220 267 N/A INTRINSIC
Pfam:Collagen 282 342 5e-10 PFAM
Pfam:Collagen 312 377 4.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101610
AA Change: S325P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099131
Gene: ENSMUSG00000034175
AA Change: S325P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 2.5e-7 PFAM
Pfam:UBA 323 358 3.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109878
AA Change: S325P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105504
Gene: ENSMUSG00000034175
AA Change: S325P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 2e-7 PFAM
SCOP:d1ifya_ 318 361 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132196
Predicted Effect probably benign
Transcript: ENSMUST00000132328
SMART Domains Protein: ENSMUSP00000117779
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
low complexity region 1 44 N/A INTRINSIC
Pfam:Collagen 59 113 4.5e-10 PFAM
Pfam:Collagen 89 152 2e-13 PFAM
low complexity region 154 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134267
Predicted Effect probably benign
Transcript: ENSMUST00000139742
Predicted Effect probably benign
Transcript: ENSMUST00000148761
SMART Domains Protein: ENSMUSP00000120264
Gene: ENSMUSG00000034175

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Rhomboid 44 187 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150632
Predicted Effect probably benign
Transcript: ENSMUST00000151906
SMART Domains Protein: ENSMUSP00000124014
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 2 68 8.4e-14 PFAM
low complexity region 72 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153308
SMART Domains Protein: ENSMUSP00000125605
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
Pfam:Collagen 1 49 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163299
SMART Domains Protein: ENSMUSP00000131391
Gene: ENSMUSG00000034164

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 33 101 7.3e-24 PFAM
low complexity region 198 209 N/A INTRINSIC
low complexity region 218 265 N/A INTRINSIC
Pfam:Collagen 280 340 5.1e-10 PFAM
Pfam:Collagen 310 375 4.3e-12 PFAM
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered stimulated NK cell activation and acute inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
4931414P19Rik A G 14: 54,584,984 Y399H probably damaging Het
5430419D17Rik T A 7: 131,239,523 D647E probably benign Het
6430573F11Rik A G 8: 36,512,298 T352A probably benign Het
Abca9 G T 11: 110,144,862 P644Q probably damaging Het
Acly T C 11: 100,522,120 probably null Het
Adamts14 A T 10: 61,227,101 probably null Het
Ankdd1a T C 9: 65,502,241 N471S probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgef28 T C 13: 97,939,492 T1345A probably benign Het
Arhgef40 T A 14: 51,996,157 L820H probably damaging Het
Atp2b4 A G 1: 133,730,510 V554A probably damaging Het
Birc7 G A 2: 180,933,336 probably null Het
Ccdc80 C T 16: 45,116,263 R684C probably benign Het
Cdc25b C A 2: 131,191,618 P159Q probably damaging Het
Chek2 G T 5: 110,855,834 probably null Het
Chil6 C T 3: 106,394,429 probably null Het
Cr2 A G 1: 195,157,190 I643T probably damaging Het
Cwf19l2 C A 9: 3,418,773 Q187K probably benign Het
Cyth4 A G 15: 78,607,075 probably null Het
Depdc5 A G 5: 32,901,490 T268A possibly damaging Het
Dnah17 G T 11: 118,043,229 probably null Het
Dnah3 T C 7: 119,971,621 Y2210C possibly damaging Het
Elmod3 G A 6: 72,594,816 probably benign Het
Eogt T A 6: 97,116,035 T394S probably benign Het
Evi5 A G 5: 107,820,451 V182A possibly damaging Het
Fbxo30 T C 10: 11,290,479 I315T probably benign Het
Fibcd1 T C 2: 31,838,617 N76S probably damaging Het
Gcc2 G T 10: 58,287,242 R1190M probably damaging Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Gm11543 T A 11: 94,828,554 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hhip G T 8: 79,996,863 D387E probably damaging Het
Hif1a T A 12: 73,937,792 Y46* probably null Het
Hivep3 G T 4: 120,123,048 probably null Het
Kif13a T A 13: 46,752,862 E535V probably damaging Het
Lrch3 T C 16: 32,914,184 Y15H probably damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Lyst T A 13: 13,759,397 V3560E probably benign Het
Megf11 T C 9: 64,686,473 F613L probably damaging Het
Misp G A 10: 79,827,143 V465M probably damaging Het
Ms4a6c T A 19: 11,478,173 D115E probably benign Het
Msh6 A G 17: 87,986,069 T751A probably benign Het
Ntrk3 T A 7: 78,451,899 T429S probably benign Het
Olfr128 T A 17: 37,923,611 M15K probably benign Het
Olfr857 T C 9: 19,713,006 Y60H probably damaging Het
Oplah A C 15: 76,296,637 *1289G probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhga6 A T 18: 37,708,528 T434S probably benign Het
Pign A G 1: 105,646,869 probably benign Het
Poteg A T 8: 27,447,968 I51F probably benign Het
Prrc2c C A 1: 162,699,031 V204F unknown Het
Rit1 T A 3: 88,729,137 L116Q probably damaging Het
Rpl22 T A 4: 152,325,802 probably benign Het
Rttn A G 18: 89,090,436 E1588G possibly damaging Het
Sardh A G 2: 27,220,723 F577S probably damaging Het
Slc12a7 T A 13: 73,785,139 D105E probably benign Het
Slc22a23 T A 13: 34,305,257 D215V probably damaging Het
Slc4a8 C A 15: 100,795,887 P438T probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Stk19 C T 17: 34,820,562 probably benign Het
Stx5a T C 19: 8,748,465 I143T probably damaging Het
Tep1 T C 14: 50,829,882 H2232R possibly damaging Het
Ttc21b A G 2: 66,236,235 I358T probably benign Het
Tuba8 A G 6: 121,225,904 D392G possibly damaging Het
Vmn1r1 G A 1: 182,157,407 P231L probably damaging Het
Zfp330 A G 8: 82,767,312 W107R probably damaging Het
Zfp715 T A 7: 43,299,692 Q281H possibly damaging Het
Zfp9 T C 6: 118,465,039 T221A probably damaging Het
Zgpat T C 2: 181,365,627 probably benign Het
Other mutations in Rhbdd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Rhbdd3 APN 11 5105424 unclassified probably benign
IGL02376:Rhbdd3 APN 11 5103192 unclassified probably benign
R1387:Rhbdd3 UTSW 11 5104121 missense probably damaging 1.00
R1438:Rhbdd3 UTSW 11 5103332 missense probably damaging 1.00
R4196:Rhbdd3 UTSW 11 5099460 unclassified probably benign
R4278:Rhbdd3 UTSW 11 5105329 missense probably benign 0.01
R4554:Rhbdd3 UTSW 11 5105946 missense probably benign 0.03
R4809:Rhbdd3 UTSW 11 5105949 missense probably damaging 0.99
R5687:Rhbdd3 UTSW 11 5105707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGACATGGAAGAACTCG -3'
(R):5'- ATGTTGGGGCCTAGTCCTAC -3'

Sequencing Primer
(F):5'- TCGGAGAGGGGCTTGGAC -3'
(R):5'- ACTAGGGCCTCAGTGTCCACTAG -3'
Posted On2016-10-26