Incidental Mutation 'R5594:Pcdhga6'
ID437741
Institutional Source Beutler Lab
Gene Symbol Pcdhga6
Ensembl Gene ENSMUSG00000103793
Gene Nameprotocadherin gamma subfamily A, 6
Synonyms
MMRRC Submission 043146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5594 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37707039-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37708528 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 434 (T434S)
Ref Sequence ENSEMBL: ENSMUSP00000141803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157868
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
AA Change: T434S

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793
AA Change: T434S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C T 11: 3,938,027 V120I unknown Het
4931414P19Rik A G 14: 54,584,984 Y399H probably damaging Het
5430419D17Rik T A 7: 131,239,523 D647E probably benign Het
6430573F11Rik A G 8: 36,512,298 T352A probably benign Het
Abca9 G T 11: 110,144,862 P644Q probably damaging Het
Acly T C 11: 100,522,120 probably null Het
Adamts14 A T 10: 61,227,101 probably null Het
Ankdd1a T C 9: 65,502,241 N471S probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgef28 T C 13: 97,939,492 T1345A probably benign Het
Arhgef40 T A 14: 51,996,157 L820H probably damaging Het
Atp2b4 A G 1: 133,730,510 V554A probably damaging Het
Birc7 G A 2: 180,933,336 probably null Het
Ccdc80 C T 16: 45,116,263 R684C probably benign Het
Cdc25b C A 2: 131,191,618 P159Q probably damaging Het
Chek2 G T 5: 110,855,834 probably null Het
Chil6 C T 3: 106,394,429 probably null Het
Cr2 A G 1: 195,157,190 I643T probably damaging Het
Cwf19l2 C A 9: 3,418,773 Q187K probably benign Het
Cyth4 A G 15: 78,607,075 probably null Het
Depdc5 A G 5: 32,901,490 T268A possibly damaging Het
Dnah17 G T 11: 118,043,229 probably null Het
Dnah3 T C 7: 119,971,621 Y2210C possibly damaging Het
Elmod3 G A 6: 72,594,816 probably benign Het
Eogt T A 6: 97,116,035 T394S probably benign Het
Evi5 A G 5: 107,820,451 V182A possibly damaging Het
Fbxo30 T C 10: 11,290,479 I315T probably benign Het
Fibcd1 T C 2: 31,838,617 N76S probably damaging Het
Gcc2 G T 10: 58,287,242 R1190M probably damaging Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Gm11543 T A 11: 94,828,554 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hhip G T 8: 79,996,863 D387E probably damaging Het
Hif1a T A 12: 73,937,792 Y46* probably null Het
Hivep3 G T 4: 120,123,048 probably null Het
Kif13a T A 13: 46,752,862 E535V probably damaging Het
Lrch3 T C 16: 32,914,184 Y15H probably damaging Het
Lyst T G 13: 13,743,333 I3326S probably damaging Het
Lyst T A 13: 13,759,397 V3560E probably benign Het
Megf11 T C 9: 64,686,473 F613L probably damaging Het
Misp G A 10: 79,827,143 V465M probably damaging Het
Ms4a6c T A 19: 11,478,173 D115E probably benign Het
Msh6 A G 17: 87,986,069 T751A probably benign Het
Ntrk3 T A 7: 78,451,899 T429S probably benign Het
Olfr128 T A 17: 37,923,611 M15K probably benign Het
Olfr857 T C 9: 19,713,006 Y60H probably damaging Het
Oplah A C 15: 76,296,637 *1289G probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pign A G 1: 105,646,869 probably benign Het
Poteg A T 8: 27,447,968 I51F probably benign Het
Prrc2c C A 1: 162,699,031 V204F unknown Het
Rhbdd3 T C 11: 5,105,710 S325P probably damaging Het
Rit1 T A 3: 88,729,137 L116Q probably damaging Het
Rpl22 T A 4: 152,325,802 probably benign Het
Rttn A G 18: 89,090,436 E1588G possibly damaging Het
Sardh A G 2: 27,220,723 F577S probably damaging Het
Slc12a7 T A 13: 73,785,139 D105E probably benign Het
Slc22a23 T A 13: 34,305,257 D215V probably damaging Het
Slc4a8 C A 15: 100,795,887 P438T probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Stk19 C T 17: 34,820,562 probably benign Het
Stx5a T C 19: 8,748,465 I143T probably damaging Het
Tep1 T C 14: 50,829,882 H2232R possibly damaging Het
Ttc21b A G 2: 66,236,235 I358T probably benign Het
Tuba8 A G 6: 121,225,904 D392G possibly damaging Het
Vmn1r1 G A 1: 182,157,407 P231L probably damaging Het
Zfp330 A G 8: 82,767,312 W107R probably damaging Het
Zfp715 T A 7: 43,299,692 Q281H possibly damaging Het
Zfp9 T C 6: 118,465,039 T221A probably damaging Het
Zgpat T C 2: 181,365,627 probably benign Het
Other mutations in Pcdhga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3551:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3552:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3688:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R3713:Pcdhga6 UTSW 18 37707923 missense probably damaging 0.99
R3832:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R3833:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R4607:Pcdhga6 UTSW 18 37708618 missense probably damaging 1.00
R5608:Pcdhga6 UTSW 18 37707461 missense possibly damaging 0.50
R5887:Pcdhga6 UTSW 18 37708559 missense probably damaging 1.00
R6188:Pcdhga6 UTSW 18 37708271 missense probably benign 0.00
R6276:Pcdhga6 UTSW 18 37707644 missense probably benign 0.28
R6494:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R6619:Pcdhga6 UTSW 18 37709649 missense probably benign 0.00
R7145:Pcdhga6 UTSW 18 37707728 missense probably damaging 0.99
R7211:Pcdhga6 UTSW 18 37709120 missense probably benign 0.01
R7313:Pcdhga6 UTSW 18 37708019 missense possibly damaging 0.60
R7425:Pcdhga6 UTSW 18 37708566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCAGGGACCGTAATTGCTC -3'
(R):5'- AAGGGTTTCTTTGGCCAGAG -3'

Sequencing Primer
(F):5'- AGGGACCGTAATTGCTCTTTTTCAAG -3'
(R):5'- GGCCAGAGAGTAAATAATTTCTGC -3'
Posted On2016-10-26