Incidental Mutation 'R0063:Cic'
ID43781
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission 038355-MU
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R0063 (G1)
Quality Score218
Status Validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25287141 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 1299 (S1299Y)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]
Predicted Effect probably benign
Transcript: ENSMUST00000005578
AA Change: S392Y

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S392Y

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163320
AA Change: S392Y

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S392Y

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably benign
Transcript: ENSMUST00000164820
SMART Domains Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165239
AA Change: S392Y

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S392Y

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: S1299Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1299Y

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170500
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik C T 16: 4,861,048 R245* probably null Het
4930563I02Rik T A 14: 60,096,028 probably benign Het
9330182L06Rik T C 5: 9,440,709 probably benign Het
Acss1 T C 2: 150,627,292 T435A probably damaging Het
Aoc2 T A 11: 101,326,071 S327T probably damaging Het
Arid5a T A 1: 36,318,564 Y252N probably damaging Het
AU040320 T C 4: 126,839,672 Y662H probably damaging Het
B4gat1 T A 19: 5,039,707 L244* probably null Het
Bcam C T 7: 19,766,848 V134I probably benign Het
Btbd16 A T 7: 130,823,166 T426S probably benign Het
Btn1a1 C T 13: 23,465,097 probably null Het
Cap2 T C 13: 46,638,032 probably benign Het
Capn8 T A 1: 182,602,112 D299E probably damaging Het
Cdipt G A 7: 126,979,600 V160I probably benign Het
Cep164 A G 9: 45,768,618 S1267P possibly damaging Het
Col3a1 T C 1: 45,330,541 probably benign Het
Cyb5r3 T C 15: 83,161,936 T60A probably benign Het
Dgkb T G 12: 38,604,113 S744A probably benign Het
Dock2 T A 11: 34,756,284 probably null Het
Ece1 C T 4: 137,948,581 T422M probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Eml3 C A 19: 8,938,478 A644D probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Foxp1 A G 6: 98,944,723 probably benign Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Il17rd G A 14: 27,082,733 C88Y probably damaging Het
Il17rd C A 14: 27,082,734 C88* probably null Het
Ino80c A G 18: 24,106,624 F160S probably damaging Het
Ints8 T C 4: 11,252,857 N75S probably damaging Het
Irf2bp1 C T 7: 19,005,847 R471C possibly damaging Het
Irs1 T A 1: 82,288,859 E545D probably damaging Het
Lama3 T C 18: 12,528,705 probably benign Het
Mast4 C A 13: 103,334,215 probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Nat8f2 A T 6: 85,867,833 S182R possibly damaging Het
Nrcam G T 12: 44,550,028 V343F possibly damaging Het
Opn5 T C 17: 42,596,626 S120G probably damaging Het
Pdk2 T C 11: 95,032,480 H106R probably benign Het
Pkhd1 G A 1: 20,211,950 T2889I probably benign Het
Pkhd1l1 T A 15: 44,529,237 L1656H probably damaging Het
Plxna2 A T 1: 194,644,939 T394S probably benign Het
Pnpla8 T A 12: 44,282,832 C56S probably damaging Het
Prdm8 G T 5: 98,184,594 R118L probably damaging Het
Prkce T C 17: 86,482,111 probably benign Het
Ptprk T A 10: 28,263,767 Y163N probably damaging Het
Rbbp8 T A 18: 11,734,557 probably benign Het
Rnh1 A T 7: 141,164,196 probably null Het
Rtn4 T A 11: 29,705,527 probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc2a2 T C 3: 28,717,440 M173T probably damaging Het
Slc2a8 T A 2: 32,979,999 probably null Het
Tdpoz1 A T 3: 93,670,814 M221K probably benign Het
Tgm7 G T 2: 121,094,096 H533Q probably benign Het
Timm29 C A 9: 21,593,008 A17E probably benign Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tmem89 A G 9: 108,914,812 N60S probably benign Het
Tpx2 A G 2: 152,880,123 T212A probably damaging Het
Trio G T 15: 27,881,437 probably benign Het
Tulp2 T C 7: 45,520,860 probably benign Het
Uggt2 A G 14: 119,007,130 probably benign Het
Vmn2r5 T A 3: 64,503,800 E449V probably benign Het
Vwa8 A G 14: 79,164,216 probably benign Het
Xirp2 A G 2: 67,509,083 D556G probably damaging Het
Xrn1 T C 9: 95,969,535 L202P probably damaging Het
Zfp354a A T 11: 51,069,571 H203L probably damaging Het
Zfp53 A C 17: 21,508,105 R133S probably benign Het
Zfp787 C T 7: 6,132,323 probably null Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTTCAAGAACTGACCCAGGTTCG -3'
(R):5'- GAAGCCGTACACTAGGAAGAGCATC -3'

Sequencing Primer
(F):5'- TTCGAGTCTCAGGTCACCAG -3'
(R):5'- TCCGTGGCTGAAGTATATCCAAC -3'
Posted On2013-05-29