Incidental Mutation 'R5596:Med12l'
ID437816
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 043148-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59252350 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1273 (N1273K)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
AA Change: N1238K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: N1238K

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
AA Change: N1273K

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: N1273K

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
AA Change: N1273K

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: N1273K

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense possibly damaging 0.92
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAAACCTAGCCTAATTTGC -3'
(R):5'- CTAAAAGTCTCCATTATCACAGCTC -3'

Sequencing Primer
(F):5'- GGGACAATATTTTGAATGTCTGTGAC -3'
(R):5'- AGTCTCCATTATCACAGCTCTTTAAC -3'
Posted On2016-10-26