Incidental Mutation 'R5598:Hsd11b2'
ID 437923
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Name hydroxysteroid 11-beta dehydrogenase 2
Synonyms 11(beta)-HSD2, 11HSD2
MMRRC Submission 043150-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5598 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 106245387-106250620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106249143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 173 (V173I)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]
AlphaFold P51661
Predicted Effect probably benign
Transcript: ENSMUST00000013304
SMART Domains Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 347 2.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034363
AA Change: V173I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: V173I

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,025,645 (GRCm39) D550G probably damaging Het
Ano6 A G 15: 95,839,228 (GRCm39) T457A probably damaging Het
Ano8 A G 8: 71,935,221 (GRCm39) V359A probably damaging Het
Aqp2 G T 15: 99,476,993 (GRCm39) probably benign Het
Atp13a5 C T 16: 29,075,829 (GRCm39) probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,741,456 (GRCm39) probably null Het
Ccr1l1 A G 9: 123,778,030 (GRCm39) V139A probably benign Het
Cecr2 A G 6: 120,708,407 (GRCm39) probably null Het
Celsr2 A G 3: 108,310,119 (GRCm39) V1537A possibly damaging Het
Chd6 T A 2: 160,856,032 (GRCm39) K741N probably damaging Het
Chrna1 T A 2: 73,397,075 (GRCm39) T405S probably benign Het
Cish T C 9: 107,174,227 (GRCm39) V5A possibly damaging Het
Cmss1 C A 16: 57,131,649 (GRCm39) C159F probably damaging Het
Col1a2 A G 6: 4,516,916 (GRCm39) probably benign Het
Cradd G T 10: 95,011,666 (GRCm39) S158* probably null Het
Dmxl1 G A 18: 49,997,545 (GRCm39) A578T probably benign Het
Drd2 A G 9: 49,318,315 (GRCm39) N419S possibly damaging Het
E4f1 T C 17: 24,666,103 (GRCm39) T232A probably damaging Het
Fat2 T A 11: 55,171,956 (GRCm39) E2919V probably damaging Het
Gc T C 5: 89,586,309 (GRCm39) probably null Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Kdm6b C T 11: 69,296,900 (GRCm39) A456T probably damaging Het
Kif18b G A 11: 102,799,015 (GRCm39) P729S possibly damaging Het
Lgi1 A G 19: 38,294,629 (GRCm39) D467G possibly damaging Het
Loxl1 A G 9: 58,219,650 (GRCm39) Y174H possibly damaging Het
Mtus1 A T 8: 41,475,592 (GRCm39) I824N probably damaging Het
Myrf C T 19: 10,192,654 (GRCm39) E622K probably benign Het
Ncam1 A G 9: 49,457,051 (GRCm39) Y416H probably damaging Het
Nceh1 A G 3: 27,280,248 (GRCm39) T132A probably benign Het
Nhlrc4 G A 17: 26,162,466 (GRCm39) P94S probably damaging Het
Or2v1 C G 11: 49,025,941 (GRCm39) D307E probably benign Het
Or52s1b A T 7: 102,822,841 (GRCm39) M1K probably null Het
Or8b1 A T 9: 38,399,821 (GRCm39) R165S possibly damaging Het
Pcdhac2 A G 18: 37,277,476 (GRCm39) Y152C probably damaging Het
Pdia3 C A 2: 121,244,611 (GRCm39) T8K possibly damaging Het
Pogz T A 3: 94,771,820 (GRCm39) V304E probably damaging Het
Snrnp200 A G 2: 127,068,007 (GRCm39) S835G possibly damaging Het
Susd4 T C 1: 182,719,635 (GRCm39) S417P probably benign Het
Thsd7b G A 1: 129,523,578 (GRCm39) R127H probably damaging Het
Tmco4 A G 4: 138,781,216 (GRCm39) D460G probably damaging Het
Ttll9 T A 2: 152,826,234 (GRCm39) M148K probably damaging Het
Ubn2 G A 6: 38,467,323 (GRCm39) C677Y probably benign Het
Vmn2r98 T C 17: 19,301,161 (GRCm39) I721T probably benign Het
Wdfy4 C A 14: 32,855,454 (GRCm39) C720F probably damaging Het
Zzef1 G A 11: 72,807,347 (GRCm39) D2742N probably damaging Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 106,249,759 (GRCm39) missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 106,249,529 (GRCm39) missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 106,249,854 (GRCm39) missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 106,248,960 (GRCm39) missense probably benign 0.00
gilberto UTSW 8 106,249,699 (GRCm39) missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 106,249,699 (GRCm39) missense possibly damaging 0.96
R1082:Hsd11b2 UTSW 8 106,249,783 (GRCm39) missense probably damaging 0.99
R2050:Hsd11b2 UTSW 8 106,249,992 (GRCm39) missense probably benign 0.27
R4135:Hsd11b2 UTSW 8 106,249,798 (GRCm39) missense probably benign
R5294:Hsd11b2 UTSW 8 106,249,929 (GRCm39) missense probably benign 0.01
R5780:Hsd11b2 UTSW 8 106,248,787 (GRCm39) missense probably damaging 1.00
R6058:Hsd11b2 UTSW 8 106,249,966 (GRCm39) missense possibly damaging 0.59
R6867:Hsd11b2 UTSW 8 106,248,949 (GRCm39) missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 106,245,755 (GRCm39) missense probably damaging 0.99
R7786:Hsd11b2 UTSW 8 106,245,506 (GRCm39) missense probably damaging 0.99
R8006:Hsd11b2 UTSW 8 106,245,735 (GRCm39) missense possibly damaging 0.95
R8110:Hsd11b2 UTSW 8 106,249,266 (GRCm39) missense probably damaging 0.98
R8889:Hsd11b2 UTSW 8 106,249,263 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACCAAGGCAGAGGACATC -3'
(R):5'- ACCGCTTTGTCTCTGAGTGG -3'

Sequencing Primer
(F):5'- AGCCGTGTTCTGGAAATCAC -3'
(R):5'- TCTCTGAGTGGAAGAGCACTTACC -3'
Posted On 2016-10-26