Incidental Mutation 'R5609:Chac1'
ID437954
Institutional Source Beutler Lab
Gene Symbol Chac1
Ensembl Gene ENSMUSG00000027313
Gene NameChaC, cation transport regulator 1
SynonymsBotch, 1810008K03Rik
MMRRC Submission 043158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5609 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119351229-119354381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119351406 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2 (K2E)
Ref Sequence ENSEMBL: ENSMUSP00000028780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028780]
Predicted Effect unknown
Transcript: ENSMUST00000028780
AA Change: K2E
SMART Domains Protein: ENSMUSP00000028780
Gene: ENSMUSG00000027313
AA Change: K2E

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:ChaC 34 209 2.2e-71 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,471,415 I408F probably damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Ago1 C A 4: 126,461,037 K127N possibly damaging Het
Akap8l T C 17: 32,338,400 N79S probably damaging Het
Ano5 T C 7: 51,593,637 L836P probably damaging Het
AY358078 A G 14: 51,804,608 T147A unknown Het
BC049730 A T 7: 24,714,286 R242S possibly damaging Het
Cabp4 T C 19: 4,139,252 D102G probably benign Het
Cdc34 C T 10: 79,684,821 R61C probably damaging Het
Cltc C T 11: 86,730,267 V305I probably damaging Het
Cog7 T C 7: 121,925,460 T704A probably benign Het
Cux1 A G 5: 136,392,320 V184A probably damaging Het
Daglb A T 5: 143,478,519 T262S probably benign Het
Dglucy A G 12: 100,787,646 I12V probably null Het
Dnah7a A G 1: 53,582,594 V1124A probably benign Het
Eef2 C CN 10: 81,178,769 probably null Het
Eif3k C A 7: 28,981,708 A9S probably benign Het
Gli3 A T 13: 15,548,453 M60L possibly damaging Het
Hk1 C T 10: 62,342,551 E4K probably benign Het
Kmt2b C A 7: 30,577,145 V1701L probably damaging Het
Lrp1b T C 2: 41,341,795 H1107R probably damaging Het
Ncor1 A G 11: 62,358,853 probably null Het
Olfr191 T A 16: 59,086,076 M136L possibly damaging Het
Olfr814 T G 10: 129,874,738 R6S probably benign Het
Plekhg4 G A 8: 105,379,502 probably null Het
Pmfbp1 G T 8: 109,525,107 E327D probably damaging Het
Slc22a17 G A 14: 54,908,970 P63L probably damaging Het
Slc37a1 G A 17: 31,338,008 V383M possibly damaging Het
Slc9a9 T A 9: 94,809,937 Y182N probably damaging Het
Slx4ip A G 2: 137,000,242 D29G probably damaging Het
St3gal5 T C 6: 72,153,462 V319A possibly damaging Het
Tbc1d10c C T 19: 4,189,882 M76I possibly damaging Het
Thrb C A 14: 18,033,526 H416N probably benign Het
Timp2 T A 11: 118,320,161 D60V probably damaging Het
Ubxn6 C T 17: 56,069,745 E216K probably benign Het
Unc79 T C 12: 103,128,268 M1977T probably benign Het
Uri1 G A 7: 37,963,529 R347* probably null Het
Vmn1r73 G A 7: 11,756,664 W136* probably null Het
Vmn2r124 T C 17: 18,073,840 Y730H probably benign Het
Wnk4 C T 11: 101,275,636 probably benign Het
Zfhx4 A G 3: 5,403,619 N2971D probably damaging Het
Other mutations in Chac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Chac1 APN 2 119353559 missense probably benign
IGL02611:Chac1 APN 2 119353453 missense probably damaging 1.00
PIT4366001:Chac1 UTSW 2 119351505 missense probably damaging 1.00
R0218:Chac1 UTSW 2 119353460 nonsense probably null
R0862:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R0864:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R1734:Chac1 UTSW 2 119353458 missense probably damaging 1.00
R5398:Chac1 UTSW 2 119353244 missense possibly damaging 0.92
R5641:Chac1 UTSW 2 119351518 missense probably damaging 1.00
R6416:Chac1 UTSW 2 119353534 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTGGCCAGAAAGAGATTTGCCC -3'
(R):5'- GCTATAGCCACGAACGAAGC -3'

Sequencing Primer
(F):5'- CCCAATCATAGGGACAGCTGG -3'
(R):5'- CCCACACGGCTGTCACTATAGG -3'
Posted On2016-10-26